Transcript: Human XR_926185.3

PREDICTED: Homo sapiens myosin light chain kinase family member 4 (MYLK4), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYLK4 (340156)
Length:
1748
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_926185.3
NBCI Gene record:
MYLK4 (340156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_926185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360051 ATCGATGAGAGCTACAATTTG pLKO_005 1278 3UTR 100% 13.200 18.480 N MYLK4 n/a
2 TRCN0000037448 GTGTGTGAATCGGGATGCTAA pLKO.1 1663 3UTR 100% 4.950 6.930 N MYLK4 n/a
3 TRCN0000037447 CTTCGAGTCTAAGAACGACAT pLKO.1 1208 3UTR 100% 4.050 5.670 N MYLK4 n/a
4 TRCN0000199509 GCGAACCTCATCCAGCTGTAC pLKO.1 1182 3UTR 100% 1.350 1.890 N MYLK4 n/a
5 TRCN0000037446 CAGCTTCTATACTGTGAGCAA pLKO.1 1004 3UTR 100% 2.640 1.848 N MYLK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_926185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15305 pDONR223 100% 36.4% None (many diffs) n/a
2 ccsbBroadEn_10023 pDONR223 100% 36.9% None (many diffs) n/a
3 ccsbBroad304_10023 pLX_304 0% 36.9% V5 (many diffs) n/a
4 TRCN0000468726 CAAAGAGTATTCCATGTAGACAAG pLX_317 32.2% 36.9% V5 (many diffs) n/a
Download CSV