Transcript: Human XR_926930.3

PREDICTED: Homo sapiens VPS41 subunit of HOPS complex (VPS41), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS41 (27072)
Length:
5956
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_926930.3
NBCI Gene record:
VPS41 (27072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_926930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034326 GCACACATTATGGCAAGGTTT pLKO.1 208 3UTR 100% 4.950 6.930 N VPS41 n/a
2 TRCN0000034327 CGACCAAACTTACTTCCCTTT pLKO.1 1899 3UTR 100% 4.050 5.670 N VPS41 n/a
3 TRCN0000307326 CTGATTGCTTGGGCCAATAAT pLKO_005 573 3UTR 100% 15.000 12.000 N VPS41 n/a
4 TRCN0000034324 CCATTGACAAACCACCATTTA pLKO.1 2134 3UTR 100% 13.200 9.240 N VPS41 n/a
5 TRCN0000287054 CCATTGACAAACCACCATTTA pLKO_005 2134 3UTR 100% 13.200 9.240 N VPS41 n/a
6 TRCN0000034325 GCCAAGTCGATATGTTGAAAT pLKO.1 788 3UTR 100% 13.200 9.240 N VPS41 n/a
7 TRCN0000286985 GCCAAGTCGATATGTTGAAAT pLKO_005 788 3UTR 100% 13.200 9.240 N VPS41 n/a
8 TRCN0000307325 TCATCTATTCCTGTACTAATG pLKO_005 2817 3UTR 100% 10.800 7.560 N VPS41 n/a
9 TRCN0000034328 GCTTTGACAGTCAGAGGCTTT pLKO.1 987 3UTR 100% 4.050 2.835 N VPS41 n/a
10 TRCN0000286984 GCTTTGACAGTCAGAGGCTTT pLKO_005 987 3UTR 100% 4.050 2.835 N VPS41 n/a
11 TRCN0000379556 AGTTGATCCACAAGCATAATC pLKO_005 1648 3UTR 100% 13.200 7.920 N VPS41 n/a
12 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 5374 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
13 TRCN0000111609 CCACTCATCTATGAAATGATT pLKO.1 1398 3UTR 100% 5.625 3.938 N Vps41 n/a
14 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 5282 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_926930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02989 pDONR223 100% 43% None 1_26del;2430_2523del;2683_5956del n/a
2 ccsbBroad304_02989 pLX_304 0% 43% V5 1_26del;2430_2523del;2683_5956del n/a
3 TRCN0000472078 CAGTGCCTTAAGAAGGGCCGATCT pLX_317 17.7% 43% V5 1_26del;2430_2523del;2683_5956del n/a
Download CSV