Transcript: Human XR_927367.3

PREDICTED: Homo sapiens ring finger protein 32 (RNF32), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF32 (140545)
Length:
2386
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927367.3
NBCI Gene record:
RNF32 (140545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039412 CCTGTGCTCATACAACACCAA pLKO.1 886 3UTR 100% 2.640 3.696 N Rnf32 n/a
2 TRCN0000034104 GCATGAGTTCTGGGTTAAGTA pLKO.1 1332 3UTR 100% 5.625 4.500 N RNF32 n/a
3 TRCN0000433205 GATCAGTGCTTGGCCATAAAT pLKO_005 932 3UTR 100% 15.000 10.500 N RNF32 n/a
4 TRCN0000414159 GAGAGCTTGCTTACTTCTAAA pLKO_005 1515 3UTR 100% 13.200 9.240 N RNF32 n/a
5 TRCN0000434613 CATGATCTTCAACTTCGAAAT pLKO_005 313 3UTR 100% 10.800 7.560 N RNF32 n/a
6 TRCN0000034108 GAGAGGATGTGTTGTTAGAAA pLKO.1 769 3UTR 100% 5.625 3.938 N RNF32 n/a
7 TRCN0000034106 TGCTCATACAACACCAACATT pLKO.1 890 3UTR 100% 5.625 3.938 N RNF32 n/a
8 TRCN0000034105 CCCAAACTAGAAGACTCAGAA pLKO.1 445 3UTR 100% 4.950 3.465 N RNF32 n/a
9 TRCN0000226362 GCTCATACAACACCAACATAG pLKO_005 891 3UTR 100% 10.800 7.560 N Rnf32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14386 pDONR223 100% 29.1% None (many diffs) n/a
2 ccsbBroad304_14386 pLX_304 0% 29.1% V5 (many diffs) n/a
3 TRCN0000473770 CTGTGGCTAACTTGGAGCGGCTAC pLX_317 62.4% 29.1% V5 (many diffs) n/a
4 ccsbBroadEn_13201 pDONR223 100% 26.1% None (many diffs) n/a
5 ccsbBroad304_13201 pLX_304 0% 26.1% V5 (many diffs) n/a
6 TRCN0000469877 TTACACTTCTAATATACCATCCTT pLX_317 57.5% 26.1% V5 (many diffs) n/a
7 TRCN0000487699 GAATAAAGAGTCCCGAAAGTGAGT pLX_317 34.3% 26.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV