Transcript: Human XR_927469.1

PREDICTED: Homo sapiens zinc finger protein 727 (ZNF727), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF727 (442319)
Length:
3049
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927469.1
NBCI Gene record:
ZNF727 (442319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107965 GCCTTTAACAATTCGTCATAT pLKO.1 2392 3UTR 100% 13.200 18.480 N LOC402524 n/a
2 TRCN0000107968 CCTACTCCTCAATCCTTATTA pLKO.1 2147 3UTR 100% 15.000 10.500 N LOC402524 n/a
3 TRCN0000339031 ATTGCTGGAGCACGACATAAA pLKO_005 434 3UTR 100% 13.200 9.240 N ZNF727 n/a
4 TRCN0000107967 GCTCGTTCTCACACGTCATTA pLKO.1 2315 3UTR 100% 13.200 9.240 N LOC402524 n/a
5 TRCN0000339034 CATACTGCAGATAGAAGTTAC pLKO_005 759 3UTR 100% 10.800 7.560 N ZNF727 n/a
6 TRCN0000339030 TAGGTGTTGCTCAGACCTTAC pLKO_005 974 3UTR 100% 6.000 4.200 N ZNF727 n/a
7 TRCN0000339033 TTGGGTTGTGCTCAATCTTCA pLKO_005 640 3UTR 100% 4.950 3.465 N ZNF727 n/a
8 TRCN0000107966 CCTGGTGAGAAACCCTACAAA pLKO.1 2269 3UTR 100% 5.625 3.375 N LOC402524 n/a
9 TRCN0000107969 CCCTGGTGAGAAACCCTACAA pLKO.1 2268 3UTR 100% 4.950 2.970 N LOC402524 n/a
10 TRCN0000339032 GCAAAGACTGTAGGTTGTCAG pLKO_005 715 3UTR 100% 4.050 2.430 N ZNF727 n/a
11 TRCN0000243748 CTGGAAAGAAACCCTACAAAT pLKO_005 847 3UTR 100% 13.200 6.600 Y Gm6871 n/a
12 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1015 3UTR 100% 13.200 6.600 Y Zfp934 n/a
13 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1015 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
14 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1015 3UTR 100% 13.200 6.600 Y EG668616 n/a
15 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 1696 3UTR 100% 10.800 5.400 Y Rex2 n/a
16 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1349 3UTR 100% 4.950 2.475 Y ZNF254 n/a
17 TRCN0000164124 CTGGAGAGAAACCCTACATAT pLKO.1 1183 3UTR 100% 13.200 6.600 Y ZNF718 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.