Transcript: Human XR_929789.2

PREDICTED: Homo sapiens ERCC excision repair 6 like 2 (ERCC6L2), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERCC6L2 (375748)
Length:
7864
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929789.2
NBCI Gene record:
ERCC6L2 (375748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929789.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018041 CGGTGCCAATGTTGTTGTATT pLKO.1 2155 3UTR 100% 13.200 18.480 N ERCC6L2 n/a
2 TRCN0000167269 CAGTCGTATGAATCAATGGAT pLKO.1 5154 3UTR 100% 3.000 4.200 N ERCC6L2 n/a
3 TRCN0000018042 GCGCACCAAGACTCTTATCAA pLKO.1 1486 3UTR 100% 5.625 4.500 N ERCC6L2 n/a
4 TRCN0000167413 GAGCTGTGATTACTACCATTA pLKO.1 7138 3UTR 100% 10.800 7.560 N ERCC6L2 n/a
5 TRCN0000167155 CCACCTTCATAATTGGAGAAA pLKO.1 5482 3UTR 100% 4.950 3.465 N ERCC6L2 n/a
6 TRCN0000018038 CCGGTTTCTTTATGGACACTA pLKO.1 769 3UTR 100% 4.950 3.465 N ERCC6L2 n/a
7 TRCN0000018040 CCTCTTAAACAGCTTCAAGAA pLKO.1 569 3UTR 100% 4.950 3.465 N ERCC6L2 n/a
8 TRCN0000018039 GCTGTCTATCAAACAGTGTTA pLKO.1 1568 3UTR 100% 4.950 3.465 N ERCC6L2 n/a
9 TRCN0000168360 GCTGTCAGATTCTGAAACCTT pLKO.1 5768 3UTR 100% 3.000 2.100 N ERCC6L2 n/a
10 TRCN0000168118 GCTTCTCAATATCCAGAGGTA pLKO.1 5637 3UTR 100% 2.640 1.848 N ERCC6L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929789.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14486 pDONR223 100% 17.5% None (many diffs) n/a
2 ccsbBroad304_14486 pLX_304 0% 17.5% V5 (many diffs) n/a
3 TRCN0000469041 ATCACAATTGGACGAATGGAGACG pLX_317 32.5% 17.5% V5 (many diffs) n/a
Download CSV