Transcript: Human XR_930485.2

PREDICTED: Homo sapiens Kin17 DNA and RNA binding protein (KIN), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIN (22944)
Length:
1666
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_930485.2
NBCI Gene record:
KIN (22944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_930485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000065 CTCAGCAGTTTATGGATTATT pLKO.1 212 3UTR 100% 15.000 10.500 N KIN n/a
2 TRCN0000295264 CTCAGCAGTTTATGGATTATT pLKO_005 212 3UTR 100% 15.000 10.500 N Kin n/a
3 TRCN0000226384 TCAGCAGTTTATGGATTATTT pLKO_005 213 3UTR 100% 15.000 10.500 N KIN n/a
4 TRCN0000000064 CCTCAGCAGTTTATGGATTAT pLKO.1 211 3UTR 100% 13.200 9.240 N KIN n/a
5 TRCN0000218858 GAAATCTGCACTGGATGAAAT pLKO_005 801 3UTR 100% 13.200 9.240 N KIN n/a
6 TRCN0000226385 CAACATTGTCTACAACGAATA pLKO_005 303 3UTR 100% 10.800 7.560 N KIN n/a
7 TRCN0000000066 CAGCTACTATCGTCATTGAAA pLKO.1 1127 3UTR 100% 5.625 3.938 N KIN n/a
8 TRCN0000000067 CTGTTGTGAAGATGATTGATT pLKO.1 971 3UTR 100% 5.625 3.938 N KIN n/a
9 TRCN0000226386 TGAAGAGAAAGTCACGTTTAA pLKO_005 627 3UTR 100% 13.200 7.920 N KIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_930485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14073 pDONR223 100% 69% None (many diffs) n/a
2 ccsbBroad304_14073 pLX_304 0% 69% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV