Transcript: Human XR_931316.3

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type O (PTPRO), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRO (5800)
Length:
6885
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931316.3
NBCI Gene record:
PTPRO (5800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342465 CTTCCGGACAATGCTATATAA pLKO_005 879 3UTR 100% 15.000 21.000 N PTPRO n/a
2 TRCN0000002903 CGTATCGTAAACTTGAACAAA pLKO.1 1084 3UTR 100% 5.625 7.875 N PTPRO n/a
3 TRCN0000342463 ATGTGGCCAAGGAGATAATTT pLKO_005 4739 3UTR 100% 15.000 10.500 N PTPRO n/a
4 TRCN0000342521 GAGCTGGACCAGACCTTATTT pLKO_005 2037 3UTR 100% 15.000 10.500 N PTPRO n/a
5 TRCN0000342520 GCCAAAGACTCTGACTATAAA pLKO_005 3184 3UTR 100% 15.000 10.500 N PTPRO n/a
6 TRCN0000367488 ACTCAAGCAAACCTATTATTG pLKO_005 1862 3UTR 100% 13.200 9.240 N PTPRO n/a
7 TRCN0000367385 AGTGGGCCCTGATGGTCATTT pLKO_005 4691 3UTR 100% 13.200 9.240 N PTPRO n/a
8 TRCN0000367483 GATGGGTTCCATATCCATATT pLKO_005 1468 3UTR 100% 13.200 9.240 N PTPRO n/a
9 TRCN0000002901 GTTGCTTGTTACCCTCATTAT pLKO.1 2901 3UTR 100% 13.200 9.240 N PTPRO n/a
10 TRCN0000002902 GCCTGTTACTTTGTGTCACTT pLKO.1 5838 3UTR 100% 4.950 3.465 N PTPRO n/a
11 TRCN0000002904 GCTTTCCATGTAACTGTCCAA pLKO.1 478 3UTR 100% 2.640 1.848 N PTPRO n/a
12 TRCN0000342464 GATGACTTTGATGCCTATATT pLKO_005 3154 3UTR 100% 15.000 9.000 N PTPRO n/a
13 TRCN0000002905 GCCAGGAATGTGTTATAGTAA pLKO.1 939 3UTR 100% 5.625 3.375 N PTPRO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01345 pDONR223 100% 52.9% None 1_393del;4042_6885del n/a
2 ccsbBroad304_01345 pLX_304 0% 52.9% V5 1_393del;4042_6885del n/a
3 TRCN0000477482 ATTAACTGTCTATCAACCTAGATC pLX_317 13% 52.9% V5 1_393del;4042_6885del n/a
4 ccsbBroadEn_11080 pDONR223 100% 25.9% None (many diffs) n/a
5 ccsbBroad304_11080 pLX_304 0% 25.9% V5 (many diffs) n/a
6 TRCN0000473217 TCAAACATAATTTAGAAGCCTTCA pLX_317 25.7% 25.9% V5 (many diffs) n/a
Download CSV