Transcript: Human XR_931766.3

PREDICTED: Homo sapiens electron transfer flavoprotein subunit alpha (ETFA), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ETFA (2108)
Length:
1568
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931766.3
NBCI Gene record:
ETFA (2108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293887 AGGAACTGACACCATTGATTT pLKO_005 350 3UTR 100% 13.200 18.480 N ETFA n/a
2 TRCN0000064416 GCGGCCTCATTGCTACGATTT pLKO.1 118 3UTR 100% 10.800 15.120 N ETFA n/a
3 TRCN0000286519 GCGGCCTCATTGCTACGATTT pLKO_005 118 3UTR 100% 10.800 15.120 N ETFA n/a
4 TRCN0000293888 CAGATATTTGTGGGTATTATA pLKO_005 1292 3UTR 100% 15.000 10.500 N ETFA n/a
5 TRCN0000064413 GCTTAGTAGCTGGAACCAAAT pLKO.1 239 3UTR 100% 10.800 7.560 N ETFA n/a
6 TRCN0000286520 GCTTAGTAGCTGGAACCAAAT pLKO_005 239 3UTR 100% 10.800 7.560 N ETFA n/a
7 TRCN0000064415 GCTTGACCAGAAATTAACAAA pLKO.1 678 3UTR 100% 5.625 3.938 N ETFA n/a
8 TRCN0000286451 GCTTGACCAGAAATTAACAAA pLKO_005 678 3UTR 100% 5.625 3.938 N ETFA n/a
9 TRCN0000064414 GAGAACTATTTATGCAGGAAA pLKO.1 516 3UTR 100% 4.950 3.465 N ETFA n/a
10 TRCN0000064417 CCAGAACTTTATATTGCTGTT pLKO.1 895 3UTR 100% 4.050 2.835 N ETFA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00518 pDONR223 100% 63.7% None 1_81del;962_1115del;1235_1568del n/a
2 ccsbBroad304_00518 pLX_304 0% 63.7% V5 1_81del;962_1115del;1235_1568del n/a
3 TRCN0000474746 GCTTGTAGTGTATATTCGTTTCAA pLX_317 43.9% 63.7% V5 1_81del;962_1115del;1235_1568del n/a
Download CSV