Transcript: Human XR_931880.1

PREDICTED: Homo sapiens SH3 domain containing GRB2 like 3, endophilin A3 (SH3GL3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3GL3 (6457)
Length:
2010
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931880.1
NBCI Gene record:
SH3GL3 (6457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154820 GCAAGCTACAGATGCGAATAT pLKO.1 1275 3UTR 100% 13.200 18.480 N SH3GL3 n/a
2 TRCN0000156068 CATACAGAGCTAAGCTAGGAA pLKO.1 750 3UTR 100% 3.000 4.200 N SH3GL3 n/a
3 TRCN0000419527 GGTGAAAGACTCTCTTGATAT pLKO_005 940 3UTR 100% 13.200 10.560 N SH3GL3 n/a
4 TRCN0000412950 ACTAAACTAGACGATGAATTT pLKO_005 641 3UTR 100% 13.200 9.240 N SH3GL3 n/a
5 TRCN0000153860 CCACTTCAGTTACTACAAGAT pLKO.1 986 3UTR 100% 4.950 3.465 N SH3GL3 n/a
6 TRCN0000155456 GAAGGAATGATACACGGAGAA pLKO.1 1915 3UTR 100% 4.050 2.835 N SH3GL3 n/a
7 TRCN0000155365 CCACTGAATATCTTCAGCCAA pLKO.1 723 3UTR 100% 0.264 0.185 N SH3GL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11130 pDONR223 100% 42.9% None 1_411del;454_604del;1427_2010del n/a
2 ccsbBroad304_11130 pLX_304 0% 42.9% V5 1_411del;454_604del;1427_2010del n/a
3 TRCN0000470237 AACTTCTATATCTTTAAACCTCTC pLX_317 44.2% 42.9% V5 1_411del;454_604del;1427_2010del n/a
Download CSV