Transcript: Human XR_931939.2

PREDICTED: Homo sapiens proline-serine-threonine phosphatase interacting protein 1 (PSTPIP1), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSTPIP1 (9051)
Length:
1729
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931939.2
NBCI Gene record:
PSTPIP1 (9051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002989 CTACGATTATACAGCGCAGAA pLKO.1 1418 3UTR 100% 4.050 5.670 N PSTPIP1 n/a
2 TRCN0000356123 ATGGAGTCCAAGAAGACATAC pLKO_005 917 3UTR 100% 10.800 7.560 N PSTPIP1 n/a
3 TRCN0000367595 GACTCCTTGAAGCAGCAAATG pLKO_005 680 3UTR 100% 10.800 7.560 N PSTPIP1 n/a
4 TRCN0000002987 GTGGAGAAGAGTCAGAACAAA pLKO.1 1013 3UTR 100% 5.625 3.938 N PSTPIP1 n/a
5 TRCN0000010750 TGCAAAGACATGGAGGAGCTA pLKO.1 554 3UTR 100% 2.640 1.848 N PSTPIP1 n/a
6 TRCN0000002988 TAAAGGAGTGCGTTCTGTTCA pLKO.1 1703 3UTR 100% 4.950 3.465 N PSTPIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07348 pDONR223 100% 55.2% None (many diffs) n/a
2 ccsbBroad304_07348 pLX_304 0% 55.2% V5 (many diffs) n/a
3 TRCN0000467183 ACACGATCCGCGTCCTTACAATAC pLX_317 13.2% 55.2% V5 (many diffs) n/a
Download CSV