Construct: ORF TRCN0000467183
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010261.1_s317c1
- Derived from:
- ccsbBroadEn_07348
- DNA Barcode:
- ACACGATCCGCGTCCTTACAATAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PSTPIP1 (9051)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467183
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | NM_003978.5 | 99.9% | 99.7% | 6G>A |
| 2 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | NM_001321136.2 | 97.8% | 97.1% | 3_4insATACCCCAGCTGCA;8_9insAAGATGCCTTTTG |
| 3 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522168.3 | 95.5% | 95.4% | 6G>A;353_409del |
| 4 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522163.2 | 94.8% | 94.7% | 6G>A;353_409del;1041_1042insGCGTCCACA |
| 5 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | NM_001321135.2 | 94.4% | 93.2% | (many diffs) |
| 6 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522164.1 | 87.8% | 87.8% | 0_1ins102;251_307del |
| 7 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | NM_001321137.1 | 86.4% | 86.2% | 1_195del;201G>A |
| 8 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522165.2 | 79.8% | 79.3% | (many diffs) |
| 9 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522166.2 | 73.3% | 68.9% | (many diffs) |
| 10 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_006720737.3 | 70.6% | 70.6% | 0_1ins366 |
| 11 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522167.2 | 68.8% | 64.8% | (many diffs) |
| 12 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XR_931937.2 | 65.8% | (many diffs) | |
| 13 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XR_931936.2 | 63.9% | (many diffs) | |
| 14 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XM_011522169.2 | 60.8% | 57.9% | (many diffs) |
| 15 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XR_931938.2 | 60.3% | (many diffs) | |
| 16 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | XR_931939.2 | 55.2% | (many diffs) | |
| 17 | human | 9051 | PSTPIP1 | proline-serine-threonine ph... | NR_135552.2 | 48.9% | (many diffs) | |
| 18 | mouse | 19200 | Pstpip1 | proline-serine-threonine ph... | NM_011193.3 | 85.1% | 87.5% | (many diffs) |
| 19 | mouse | 19200 | Pstpip1 | proline-serine-threonine ph... | XM_006510866.2 | 83.3% | 85.3% | (many diffs) |
| 20 | mouse | 19200 | Pstpip1 | proline-serine-threonine ph... | XM_011242677.2 | 82.9% | 85.3% | (many diffs) |
| 21 | mouse | 19200 | Pstpip1 | proline-serine-threonine ph... | XM_006510865.2 | 80.2% | 82.1% | (many diffs) |
| 22 | mouse | 19200 | Pstpip1 | proline-serine-threonine ph... | XM_006510868.2 | 59.2% | 60.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1314
- ORF length:
- 1248
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat accccagctg cagttcaaag atgccttttg gtgcagggac ttcacagccc 121 acacgggcta cgaggtgctg ctgcagcggc ttctggatgg caggaagatg tgcaaagaca 181 tggaggagct actgaggcag agggcccagg cggaggagcg gtacgggaag gagctggtgc 241 agatcgcacg gaaggcaggt ggccagacgg agatcaactc cctgagggcc tcctttgact 301 ccttgaagca gcaaatggag aatgtgggca gctcacacat ccagctggcc ctgaccctgc 361 gtgaggagct gcggagtctc gaggagtttc gtgagaggca gaaggagcag aggaagaagt 421 atgaggccgt catggaccgg gtccagaaga gcaagctgtc gctctacaag aaggccatgg 481 agtccaagaa gacatacgag cagaagtgcc gggacgcgga cgacgcggag caggccttcg 541 agcgcattag cgccaacggc caccagaagc aggtggagaa gagtcagaac aaagccaggc 601 agtgcaagga ctcggccacc gaggcagagc gggtatacag gcagagcatt gcgcagctgg 661 agaaggtccg ggctgagtgg gagcaggagc accggaccac ctgtgaggcc tttcagctgc 721 aagagtttga ccggctgacc attctccgca acgccctgtg ggtgcacagc aaccagctct 781 ccatgcagtg tgtcaaggat gatgagctct acgaggaagt gcggctgacg ctggaaggct 841 gcagcataga cgccgacatc gacagtttca tccaggccaa gagcacgggc acagagcccc 901 ccgctccggt gccctaccag aactattacg atcgggaggt caccccgctg accagcagcc 961 ctggcataca gccgtcctgc ggcatgataa agaggttctc tggactgctg cacggaagtc 1021 ccaagaccac ttcgttggca gcttctgctg cgtccacaga gaccctgacc cccacccccg 1081 agcggaatga gggtgtctac acagccatcg cagtgcagga gatacaggga aacccggcct 1141 caccagccca ggagtaCCGG GCGCTCTACG ATTATACAGC GCAGAACCCA GATGAGCTGG 1201 ACCTGTCCGC GGGAGACATC CTGGAGGTGA TCCTGGAAGG GGAGGATGGC TGGTGGACTG 1261 TGGAGAGGAA CGGGCAGCGT GGCTTCGTCC CTGGTTCCTA CCTGGAGAAG CTTTGCCCAA 1321 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1381 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1441 TATCTTGTGG AAAGGACGAA CACGATCCGC GTCCTTACAA TACACGCGTT AAGTCgacaa 1501 tcaacctctg gattacaaaa tttgtgaaag att