Transcript: Human XR_933267.1

PREDICTED: Homo sapiens component of oligomeric golgi complex 4 (COG4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COG4 (25839)
Length:
2215
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_933267.1
NBCI Gene record:
COG4 (25839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_933267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149947 GCAGGAGCTAATTGGCTTATA pLKO.1 1249 3UTR 100% 13.200 18.480 N COG4 n/a
2 TRCN0000179190 GCTATACTTACGCTTCCTCAA pLKO.1 1111 3UTR 100% 4.050 5.670 N COG4 n/a
3 TRCN0000146584 CCATTGAAAGTAAGATGGTCA pLKO.1 216 3UTR 100% 2.640 3.696 N COG4 n/a
4 TRCN0000423404 CATCTTTGCAGATACACTTAC pLKO_005 808 3UTR 100% 10.800 7.560 N COG4 n/a
5 TRCN0000148526 CAACAAATTCCGAGACCTCTT pLKO.1 1749 3UTR 100% 4.050 2.835 N COG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_933267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11773 pDONR223 100% 53.6% None (many diffs) n/a
2 ccsbBroad304_11773 pLX_304 0% 53.6% V5 (many diffs) n/a
3 TRCN0000473203 GGCAGCCGTAAACCACCACTTTGC pLX_317 19.5% 53.6% V5 (many diffs) n/a
4 ccsbBroadEn_11772 pDONR223 100% 53.5% None (many diffs) n/a
5 ccsbBroad304_11772 pLX_304 0% 53.5% V5 (many diffs) n/a
6 TRCN0000478927 GAGTTTGCTCACGATATCGATTAC pLX_317 20.6% 53.5% V5 (many diffs) n/a
Download CSV