Transcript: Human XR_934111.2

PREDICTED: Homo sapiens dynein regulatory complex subunit 3 (DRC3), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DRC3 (83450)
Length:
1502
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934111.2
NBCI Gene record:
DRC3 (83450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141567 CCGGATTGACAACATGATGAA pLKO.1 820 3UTR 100% 4.950 6.930 N DRC3 n/a
2 TRCN0000139158 CCTAGAATGCAGTGCTGACAT pLKO.1 1469 3UTR 100% 4.950 3.465 N DRC3 n/a
3 TRCN0000139159 CCTCTGGCAGTTTGAGAACTT pLKO.1 577 3UTR 100% 4.950 3.465 N DRC3 n/a
4 TRCN0000142656 GCAGCTGGACAATAACATCAT pLKO.1 607 3UTR 100% 4.950 3.465 N DRC3 n/a
5 TRCN0000140452 GATGGACGATGACATGCTCAA pLKO.1 373 3UTR 100% 4.050 2.835 N DRC3 n/a
6 TRCN0000140486 GAGCTTGTTCAACAACCGGAT pLKO.1 739 3UTR 100% 2.160 1.512 N DRC3 n/a
7 TRCN0000140168 GAGTTGGAACTGCCCAACATT pLKO.1 1437 3UTR 100% 0.563 0.394 N DRC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470097 ACGGGGGTTCCTAGATATATGTCT pLX_317 32.3% 55.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_16018 pDONR223 0% 48% None (many diffs) n/a
3 ccsbBroad304_16018 pLX_304 0% 48% V5 (many diffs) n/a
4 ccsbBroadEn_04268 pDONR223 100% 48.1% None (many diffs) n/a
5 ccsbBroad304_04268 pLX_304 0% 48.1% V5 (many diffs) n/a
6 TRCN0000469826 TTGTTGCAAGTTCTTCCCAACTCA pLX_317 30% 48.1% V5 (many diffs) n/a
Download CSV