Transcript: Human XR_934129.3

PREDICTED: Homo sapiens small G protein signaling modulator 2 (SGSM2), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGSM2 (9905)
Length:
3300
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934129.3
NBCI Gene record:
SGSM2 (9905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271655 AGCATTCGCTCCGTGGATATG pLKO_005 2609 3UTR 100% 10.800 8.640 N SGSM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14032 pDONR223 100% 37.9% None (many diffs) n/a
2 ccsbBroad304_14032 pLX_304 0% 37.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477986 TCTGCATGAAGTGAAGCCCGGGGC pLX_317 9.1% 37.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV