Transcript: Human XR_934499.2

PREDICTED: Homo sapiens ras homolog family member T1 (RHOT1), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOT1 (55288)
Length:
2938
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934499.2
NBCI Gene record:
RHOT1 (55288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353760 GTGGACGCTCACGACTTATTT pLKO_005 1130 3UTR 100% 15.000 21.000 N RHOT1 n/a
2 TRCN0000330652 TAAATCCTACTATGCGATTAA pLKO_005 1394 3UTR 100% 13.200 18.480 N RHOT1 n/a
3 TRCN0000330651 TGGACTGTGCTTCGACGATTT pLKO_005 837 3UTR 100% 10.800 15.120 N RHOT1 n/a
4 TRCN0000048613 GCAATCCCAAATCCTTTGAAT pLKO.1 1531 3UTR 100% 5.625 4.500 N RHOT1 n/a
5 TRCN0000353761 ATGATCCTTTGGGTTCTATAA pLKO_005 2367 3UTR 100% 13.200 9.240 N RHOT1 n/a
6 TRCN0000048615 CCTGGATTTGACACCTGAATA pLKO.1 872 3UTR 100% 13.200 9.240 N RHOT1 n/a
7 TRCN0000330653 GATATCTCAGAATCGGAATTT pLKO_005 1458 3UTR 100% 13.200 9.240 N RHOT1 n/a
8 TRCN0000048614 CGGGCAGAAGAAATCACCATT pLKO.1 141 3UTR 100% 4.950 3.465 N RHOT1 n/a
9 TRCN0000048617 CTTCCTATTATGAACCAGTAT pLKO.1 429 3UTR 100% 4.950 3.465 N RHOT1 n/a
10 TRCN0000048616 GCTGTTACAGTGACAAGAGAT pLKO.1 1227 3UTR 100% 4.950 3.465 N RHOT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15895 pDONR223 0% 63.1% None 1_35del;1572_1623del;1942_2938del n/a
2 ccsbBroad304_15895 pLX_304 0% 63.1% V5 1_35del;1572_1623del;1942_2938del n/a
3 TRCN0000470433 CATTGAGCAGTGACATAAGTATGG pLX_317 21.6% 63.1% V5 1_35del;1572_1623del;1942_2938del n/a
Download CSV