Transcript: Human XR_935061.2

PREDICTED: Homo sapiens ankyrin repeat domain 30B (ANKRD30B), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD30B (374860)
Length:
4547
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_935061.2
NBCI Gene record:
ANKRD30B (374860)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_935061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162727 CGTGTTTACCTGATGCTACAT pLKO.1 1446 3UTR 100% 4.950 6.930 N ANKRD30B n/a
2 TRCN0000159026 GTAGAGCCTATATTCAGTCTT pLKO.1 1325 3UTR 100% 4.950 6.930 N ANKRD30B n/a
3 TRCN0000165623 GCTCAGATGTTCCCATCAGAA pLKO.1 1757 3UTR 100% 4.950 3.465 N ANKRD30B n/a
4 TRCN0000159871 GCAAATGCAAACGCATTTAAT pLKO.1 671 3UTR 100% 1.500 1.050 N ANKRD30B n/a
5 TRCN0000160363 CTTCCAAATAAAGCCTTAGAA pLKO.1 1964 3UTR 100% 5.625 3.375 N ANKRD30B n/a
6 TRCN0000161663 GCCATGCAGAAGTAGTAACAT pLKO.1 336 3UTR 100% 5.625 2.813 Y ANKRD30B n/a
7 TRCN0000167527 GAGAAAGCAGAAAGAGAAGTA pLKO.1 4289 3UTR 100% 4.950 2.475 Y ANKRD36B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_935061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10303 pDONR223 100% 3.6% None (many diffs) n/a
2 ccsbBroad304_10303 pLX_304 0% 3.6% V5 (many diffs) n/a
3 TRCN0000476207 CTCACACCATTTCATCTACCCCAA pLX_317 100% 3.6% V5 (many diffs) n/a
Download CSV