Transcript: Human XR_935199.1

PREDICTED: Homo sapiens ankyrin repeat domain 29 (ANKRD29), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD29 (147463)
Length:
3302
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_935199.1
NBCI Gene record:
ANKRD29 (147463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_935199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285001 ACGATGGCACAACAGCATTAT pLKO_005 722 3UTR 100% 13.200 18.480 N ANKRD29 n/a
2 TRCN0000005436 GTCAGGTACAACTGCCCTATT pLKO.1 331 3UTR 100% 10.800 15.120 N ANKRD29 n/a
3 TRCN0000005433 GCTCTATTGTTGGGAATCTAT pLKO.1 1799 3UTR 100% 5.625 7.875 N ANKRD29 n/a
4 TRCN0000273505 TACTTGGATGTTATTCGATTA pLKO_005 569 3UTR 100% 10.800 8.640 N ANKRD29 n/a
5 TRCN0000273558 AGCTAACTTAGCTCCATATTT pLKO_005 997 3UTR 100% 15.000 10.500 N ANKRD29 n/a
6 TRCN0000273560 TGTATGTCATTCCAGTATAAA pLKO_005 1474 3UTR 100% 15.000 10.500 N ANKRD29 n/a
7 TRCN0000005437 CAAAGGGTATAATGATGTCAT pLKO.1 756 3UTR 100% 4.950 3.465 N ANKRD29 n/a
8 TRCN0000005434 GCCATAATGATGTCGTGAGAT pLKO.1 369 3UTR 100% 4.950 3.465 N ANKRD29 n/a
9 TRCN0000005435 TCCCTGAGAAACAAGGCCAAT pLKO.1 904 3UTR 100% 4.050 2.835 N ANKRD29 n/a
10 TRCN0000273559 TCCCTGAGAAACAAGGCCAAT pLKO_005 904 3UTR 100% 4.050 2.835 N ANKRD29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_935199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09647 pDONR223 100% 27.1% None (many diffs) n/a
2 ccsbBroad304_09647 pLX_304 0% 27.1% V5 (many diffs) n/a
3 TRCN0000470863 CACTCTGCGTTCGAGAACACGTGC pLX_317 49% 27.1% V5 (many diffs) n/a
Download CSV