Transcript: Human XR_935225.2

PREDICTED: Homo sapiens ring finger protein 138 (RNF138), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF138 (51444)
Length:
3519
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_935225.2
NBCI Gene record:
RNF138 (51444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_935225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033835 GCATGAGACATCATTACAAAT pLKO.1 745 3UTR 100% 13.200 9.240 N RNF138 n/a
2 TRCN0000296488 GTCCTACACCGAAGATGATTT pLKO_005 482 3UTR 100% 13.200 9.240 N RNF138 n/a
3 TRCN0000296430 TTTGAACGATGTGATTGATAT pLKO_005 1569 3UTR 100% 13.200 9.240 N RNF138 n/a
4 TRCN0000033837 GCTAGATGAAGAAACCCAATA pLKO.1 1133 3UTR 100% 10.800 6.480 N RNF138 n/a
5 TRCN0000289971 GCTAGATGAAGAAACCCAATA pLKO_005 1133 3UTR 100% 10.800 6.480 N RNF138 n/a
6 TRCN0000033834 CCCTGTGTCAAGAATCAAATT pLKO.1 934 3UTR 100% 13.200 6.600 Y RNF138 n/a
7 TRCN0000289973 CCCTGTGTCAAGAATCAAATT pLKO_005 934 3UTR 100% 13.200 6.600 Y RNF138 n/a
8 TRCN0000033836 CCTAGCCAGATTACCAGAAAT pLKO.1 1053 3UTR 100% 13.200 6.600 Y RNF138 n/a
9 TRCN0000289899 CCTAGCCAGATTACCAGAAAT pLKO_005 1053 3UTR 100% 13.200 6.600 Y RNF138 n/a
10 TRCN0000033838 GTCGTGGAAATGTGACTAGAA pLKO.1 625 3UTR 100% 4.950 2.475 Y RNF138 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_935225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03309 pDONR223 100% 20.8% None 1_455del;1191_3519del n/a
2 ccsbBroad304_03309 pLX_304 0% 20.8% V5 1_455del;1191_3519del n/a
3 TRCN0000471271 AACGGCGGTGCTAGGCGGGGCCCA pLX_317 53.5% 20.8% V5 1_455del;1191_3519del n/a
Download CSV