Transcript: Human XR_935712.2

PREDICTED: Homo sapiens ubiquitin like modifier activating enzyme 2 (UBA2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBA2 (10054)
Length:
2847
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_935712.2
NBCI Gene record:
UBA2 (10054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_935712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284899 CTACTAAGGAATGGGCTAAAT pLKO_005 1067 3UTR 100% 13.200 18.480 N UBA2 n/a
2 TRCN0000007474 CCTGACTATAATGTGGAATTT pLKO.1 646 3UTR 100% 13.200 9.240 N UBA2 n/a
3 TRCN0000007471 GCTGCCCGAAACCATGTTAAT pLKO.1 709 3UTR 100% 13.200 9.240 N UBA2 n/a
4 TRCN0000007470 GCTGTATTGAAAGTAGGAATA pLKO.1 2347 3UTR 100% 10.800 7.560 N UBA2 n/a
5 TRCN0000272905 GCTGTATTGAAAGTAGGAATA pLKO_005 2347 3UTR 100% 10.800 7.560 N UBA2 n/a
6 TRCN0000007473 GCTGGGTTGATAGTATTGGAA pLKO.1 1534 3UTR 100% 3.000 2.100 N UBA2 n/a
7 TRCN0000272903 GCTGGGTTGATAGTATTGGAA pLKO_005 1534 3UTR 100% 3.000 2.100 N UBA2 n/a
8 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 466 3UTR 100% 1.080 0.540 Y GPR83 n/a
9 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 466 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_935712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07539 pDONR223 100% 61.8% None (many diffs) n/a
2 ccsbBroad304_07539 pLX_304 0% 61.8% V5 (many diffs) n/a
3 TRCN0000473116 TTCTGCAATGCAATCGGTGTTCCA pLX_317 18.7% 61.8% V5 (many diffs) n/a
Download CSV