Transcript: Human XR_935748.2

PREDICTED: Homo sapiens family with sequence similarity 98 member C (FAM98C), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM98C (147965)
Length:
1251
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_935748.2
NBCI Gene record:
FAM98C (147965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_935748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166748 CCAGAATCGGACATCTCCATT pLKO.1 804 3UTR 100% 4.950 6.930 N FAM98C n/a
2 TRCN0000436900 GAACTGGACCTTACCCTCCAA pLKO_005 496 3UTR 100% 2.640 3.696 N FAM98C n/a
3 TRCN0000434235 ATGCTAATGCTATCGGTAATC pLKO_005 1089 3UTR 100% 10.800 8.640 N FAM98C n/a
4 TRCN0000436713 AGGGCAGTGCTGATCCCAATT pLKO_005 768 3UTR 100% 10.800 7.560 N FAM98C n/a
5 TRCN0000166402 CAAAGCCTCAGAGATCAGTAC pLKO.1 654 3UTR 100% 4.050 2.835 N FAM98C n/a
6 TRCN0000166625 CCTCACTACATCTGCTTTCCA pLKO.1 710 3UTR 100% 3.000 2.100 N FAM98C n/a
7 TRCN0000166204 CTACATCTGCTTTCCACTGGA pLKO.1 715 3UTR 100% 2.640 1.848 N FAM98C n/a
8 TRCN0000435802 TCTGCTGGATCCGAGTCCTAG pLKO_005 429 3UTR 100% 1.350 0.945 N FAM98C n/a
9 TRCN0000164785 CCAAAGCCTCAGAGATCAGTA pLKO.1 653 3UTR 100% 4.950 2.970 N FAM98C n/a
10 TRCN0000160007 CAAGAAGAAGAAGAAGAAGTA pLKO.1 1028 3UTR 100% 4.950 2.475 Y FAM98C n/a
11 TRCN0000166109 GCAGGAGTTGCATGCTAAGAT pLKO.1 567 3UTR 100% 5.625 3.938 N FAM98C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_935748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09651 pDONR223 100% 79.1% None (many diffs) n/a
2 ccsbBroad304_09651 pLX_304 0% 79.1% V5 (many diffs) n/a
3 TRCN0000475873 TAACTGGTAGTCAAAAGGATACTC pLX_317 33.7% 79.1% V5 (many diffs) n/a
4 ccsbBroadEn_16104 pDONR223 0% 44.8% None (many diffs) n/a
5 ccsbBroad304_16104 pLX_304 0% 44.8% V5 (many diffs) n/a
Download CSV