Transcript: Human XR_938799.3

PREDICTED: Homo sapiens nuclear assembly factor 1 ribonucleoprotein (NAF1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAF1 (92345)
Length:
2925
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_938799.3
NBCI Gene record:
NAF1 (92345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_938799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422154 GTTGAAGAACTCACTATTATT pLKO_005 736 3UTR 100% 15.000 21.000 N NAF1 n/a
2 TRCN0000135721 GACTAACCTACCTCCAGTTAA pLKO.1 834 3UTR 100% 13.200 18.480 N NAF1 n/a
3 TRCN0000133774 CGTCTTCTTCCTCTTGTATAT pLKO.1 605 3UTR 100% 13.200 9.240 N NAF1 n/a
4 TRCN0000134380 GCTGGAAACTCTGAAATTCAA pLKO.1 213 3UTR 100% 5.625 3.938 N NAF1 n/a
5 TRCN0000134443 GATTTCCTTCTCAGAGACAAA pLKO.1 1406 3UTR 100% 4.950 3.465 N NAF1 n/a
6 TRCN0000133676 GCAGGAAAGATATTCGAGATA pLKO.1 892 3UTR 100% 4.950 3.465 N NAF1 n/a
7 TRCN0000135257 CCAGTTAATGAGGAGACTGTA pLKO.1 847 3UTR 100% 4.950 2.970 N NAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_938799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09337 pDONR223 100% 50.5% None (many diffs) n/a
2 ccsbBroad304_09337 pLX_304 0% 50.5% V5 (many diffs) n/a
3 TRCN0000480972 TTAGACCACTTCGGCAAAACTTTA pLX_317 13.7% 50.5% V5 (many diffs) n/a
Download CSV