Transcript: Human XR_941559.2

PREDICTED: Homo sapiens nuclear FMR1 interacting protein 1 (NUFIP1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUFIP1 (26747)
Length:
1282
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_941559.2
NBCI Gene record:
NUFIP1 (26747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_941559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336989 ATGCTTCCACATCGTGGTATT pLKO_005 385 3UTR 100% 10.800 15.120 N NUFIP1 n/a
2 TRCN0000168255 CCAGTTCCATTGGAGAAATAT pLKO.1 686 3UTR 100% 15.000 10.500 N NUFIP1 n/a
3 TRCN0000336992 GATGTCCAGACATTCACAAAT pLKO_005 887 3UTR 100% 13.200 9.240 N NUFIP1 n/a
4 TRCN0000172320 CAGGCAGTCACTTGTGTGATT pLKO.1 982 3UTR 100% 4.950 3.465 N NUFIP1 n/a
5 TRCN0000168556 GCAGTATTGACAACAACACAA pLKO.1 849 3UTR 100% 4.950 3.465 N NUFIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_941559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11835 pDONR223 100% 26.9% None 1_704del;1069_1198del;1282_1283ins380 n/a
2 ccsbBroad304_11835 pLX_304 0% 26.9% V5 1_704del;1069_1198del;1282_1283ins380 n/a
3 TRCN0000467693 GAAACCTAACCACCAAGTTGTTGA pLX_317 15.5% 26.9% V5 1_704del;1069_1198del;1282_1283ins380 n/a
Download CSV