Transcript: Human XR_944509.3

PREDICTED: Homo sapiens MLX interacting protein (MLXIP), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLXIP (22877)
Length:
8280
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944509.3
NBCI Gene record:
MLXIP (22877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425041 ATGTTTGACGAATACGTGAAA pLKO_005 2443 3UTR 100% 4.950 6.930 N MLXIP n/a
2 TRCN0000017693 CGCCAGTTTGATCACATGAAA pLKO.1 2419 3UTR 100% 5.625 4.500 N MLXIP n/a
3 TRCN0000432399 GTATCTGGAGAAGCGCAAGAA pLKO_005 629 3UTR 100% 4.950 3.960 N MLXIP n/a
4 TRCN0000435176 AGTTTGCTGGAGTCAACAAAG pLKO_005 1528 3UTR 100% 10.800 7.560 N MLXIP n/a
5 TRCN0000419605 GAAATAGCACATCTGGGAAAT pLKO_005 1014 3UTR 100% 10.800 7.560 N MLXIP n/a
6 TRCN0000419240 GCCCAAGAAGGGCTACGATTT pLKO_005 386 3UTR 100% 10.800 7.560 N MLXIP n/a
7 TRCN0000017695 GTGTCCTTGGTGTTGAAGAAT pLKO.1 1806 3UTR 100% 5.625 3.938 N MLXIP n/a
8 TRCN0000433498 CCAACCACAAGCGGTGATCAT pLKO_005 1856 3UTR 100% 4.950 3.465 N MLXIP n/a
9 TRCN0000017697 GAGATTGTGATCCGGGAGTAT pLKO.1 756 3UTR 100% 4.950 3.465 N MLXIP n/a
10 TRCN0000433410 GCAGTTGGAAGGCGTCTTTCT pLKO_005 3218 3UTR 100% 4.950 3.465 N MLXIP n/a
11 TRCN0000017694 GCTCTTCGAGTGCATGACTTT pLKO.1 494 3UTR 100% 4.950 3.465 N MLXIP n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5559 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 5294 3UTR 100% 4.050 2.025 Y ERN2 n/a
14 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 5627 3UTR 100% 13.200 6.600 Y IQCC n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5560 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5634 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11638 pDONR223 98.2% 7.3% None (many diffs) n/a
2 ccsbBroad304_11638 pLX_304 0% 7.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV