Transcript: Human XR_944720.3

PREDICTED: Homo sapiens acyl-CoA synthetase short chain family member 3 (ACSS3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSS3 (79611)
Length:
2024
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944720.3
NBCI Gene record:
ACSS3 (79611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944720.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151676 GCTCGGTGTTTAGGAAATATT pLKO.1 1570 3UTR 100% 15.000 21.000 N ACSS3 n/a
2 TRCN0000343483 GCTCGGTGTTTAGGAAATATT pLKO_005 1570 3UTR 100% 15.000 21.000 N ACSS3 n/a
3 TRCN0000154774 GCTGGAGAACGATGTGATGTA pLKO.1 1354 3UTR 100% 4.950 3.465 N ACSS3 n/a
4 TRCN0000343482 GCTGGAGAACGATGTGATGTA pLKO_005 1354 3UTR 100% 4.950 3.465 N ACSS3 n/a
5 TRCN0000431521 TTGTTGGACATTCCTATATTT pLKO_005 1118 3UTR 100% 15.000 10.500 N Acss3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944720.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04089 pDONR223 99.3% 79.9% None 1_84del;1803_1928del;2024_2025ins244 n/a
2 ccsbBroad304_04089 pLX_304 0% 79.9% V5 (not translated due to prior stop codon) 1_84del;1803_1928del;2024_2025ins244 n/a
3 TRCN0000474580 AACCATATGTGTTGTCGACATTGC pLX_317 15.6% 79.9% V5 (not translated due to prior stop codon) 1_84del;1803_1928del;2024_2025ins244 n/a
Download CSV