Transcript: Human XR_945602.2

PREDICTED: Homo sapiens PDZ domain containing 8 (PDZD8), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDZD8 (118987)
Length:
1573
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_945602.2
NBCI Gene record:
PDZD8 (118987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_945602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121746 CGTCTTAAAGTTACGTTGTTA pLKO.1 1229 3UTR 100% 5.625 7.875 N PDZD8 n/a
2 TRCN0000121717 CCGTCTTAAAGTTACGTTGTT pLKO.1 1228 3UTR 100% 4.950 6.930 N PDZD8 n/a
3 TRCN0000140152 GCTCCTAAGGGAGTACCTTTA pLKO.1 427 3UTR 100% 10.800 7.560 N PDZD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_945602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04735 pDONR223 100% 30.6% None (many diffs) n/a
2 ccsbBroad304_04735 pLX_304 0% 30.6% V5 (many diffs) n/a
3 TRCN0000492331 TCCCTGAGGAAGGAACTCCTAATC pLX_317 10.8% 30.6% V5 (many diffs) n/a
Download CSV