Transcript: Human XR_946682.2

PREDICTED: Homo sapiens XK related 8 (XKR8), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XKR8 (55113)
Length:
1391
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946682.2
NBCI Gene record:
XKR8 (55113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139411 CTCTGAGTTTGACTTGGCCTA pLKO.1 858 3UTR 100% 2.160 1.512 N XKR8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03525 pDONR223 100% 42.6% None 1_513del;1004_1111del;1391_1392ins415 n/a
2 ccsbBroad304_03525 pLX_304 0% 42.6% V5 1_513del;1004_1111del;1391_1392ins415 n/a
3 TRCN0000479642 AAATAACTCATGGGATTTACCAAT pLX_317 26.4% 42.6% V5 1_513del;1004_1111del;1391_1392ins415 n/a
Download CSV