Transcript: Human XR_948238.1

PREDICTED: Homo sapiens solute carrier family 38 member 9 (SLC38A9), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A9 (153129)
Length:
2779
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_948238.1
NBCI Gene record:
SLC38A9 (153129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_948238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422821 ATAGGAGGGATCATAAGATAT pLKO_005 1948 3UTR 100% 13.200 18.480 N SLC38A9 n/a
2 TRCN0000429642 CATTGGAGCAATGATAGTTTA pLKO_005 1062 3UTR 100% 13.200 18.480 N SLC38A9 n/a
3 TRCN0000150636 GCTTATATGCTGGTGACATTA pLKO.1 1621 3UTR 100% 13.200 18.480 N SLC38A9 n/a
4 TRCN0000154040 CCATCGGATCTAAGATCCAAA pLKO.1 526 3UTR 100% 4.950 6.930 N SLC38A9 n/a
5 TRCN0000153884 CAGACATTATTTCGGCTCCTT pLKO.1 1002 3UTR 100% 2.640 3.696 N SLC38A9 n/a
6 TRCN0000151238 GCCTTGACAACAGTTCTATAT pLKO.1 2174 3UTR 100% 13.200 9.240 N SLC38A9 n/a
7 TRCN0000431987 GGGTGTCAGAGCAGCATATTG pLKO_005 2475 3UTR 100% 13.200 9.240 N SLC38A9 n/a
8 TRCN0000429700 TTTGTACCAGAGATAAGATTT pLKO_005 1486 3UTR 100% 13.200 9.240 N SLC38A9 n/a
9 TRCN0000152456 CCTGACAACAGCTCTATGATT pLKO.1 1225 3UTR 100% 5.625 3.938 N SLC38A9 n/a
10 TRCN0000150620 GCTAACCTGATTGTTCAGTTT pLKO.1 2101 3UTR 100% 4.950 3.465 N SLC38A9 n/a
11 TRCN0000153429 GCATTGCTTATATGCTGGTGA pLKO.1 1616 3UTR 100% 2.640 1.848 N SLC38A9 n/a
12 TRCN0000156474 CCTCTACTGTTTGGGACAGTA pLKO.1 2578 3UTR 100% 0.495 0.347 N SLC38A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_948238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09693 pDONR223 100% 57.6% None (many diffs) n/a
2 ccsbBroad304_09693 pLX_304 0% 57.6% V5 (many diffs) n/a
Download CSV