Transcript: Human XR_949019.1

PREDICTED: Homo sapiens EF-hand domain containing 2 (EFHC2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFHC2 (80258)
Length:
4870
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_949019.1
NBCI Gene record:
EFHC2 (80258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_949019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149229 GCAACCAGCATCATACCTTAA pLKO.1 2203 3UTR 100% 10.800 7.560 N EFHC2 n/a
2 TRCN0000148883 CTGAATTGCAACCAGCATCAT pLKO.1 2196 3UTR 100% 4.950 3.465 N EFHC2 n/a
3 TRCN0000149299 GCAAATCCTCCAGATTACCTT pLKO.1 2067 3UTR 100% 3.000 2.100 N EFHC2 n/a
4 TRCN0000147414 GAATTTGTAACCATTGCACGT pLKO.1 1872 3UTR 100% 2.160 1.512 N EFHC2 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2869 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_949019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04197 pDONR223 100% 46.1% None 1_77del;2023_2024delAA;2327_4870del n/a
2 ccsbBroad304_04197 pLX_304 0% 46.1% V5 1_77del;2023_2024delAA;2327_4870del n/a
3 TRCN0000481332 ATTAGGTCAAATGGACCTCCCGCG pLX_317 18.7% 46.1% V5 1_77del;2023_2024delAA;2327_4870del n/a
Download CSV