Transcript: Human XR_949954.2

PREDICTED: Homo sapiens membrane spanning 4-domains A13 (MS4A13), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MS4A13 (503497)
Length:
994
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_949954.2
NBCI Gene record:
MS4A13 (503497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_949954.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145597 CGACTCGATCTGGAATTATAA pLKO.1 527 3UTR 100% 15.000 21.000 N MS4A13 n/a
2 TRCN0000144050 CGTATGAACCTGTAACTTACA pLKO.1 434 3UTR 100% 4.950 6.930 N MS4A13 n/a
3 TRCN0000121820 GAACGTATGAACCTGTAACTT pLKO.1 431 3UTR 100% 5.625 4.500 N MS4A13 n/a
4 TRCN0000140497 GTATCCGACTCGATCTGGAAT pLKO.1 522 3UTR 100% 4.950 3.960 N MS4A13 n/a
5 TRCN0000122683 GCAGGAGTCTTCCTAATAAGA pLKO.1 493 3UTR 100% 5.625 3.938 N MS4A13 n/a
6 TRCN0000122474 CTGTTCTTCTACGGTTTGGAA pLKO.1 691 3UTR 100% 3.000 2.100 N MS4A13 n/a
7 TRCN0000143403 CTTTGGAACGTATGAACCTGT pLKO.1 426 3UTR 100% 2.640 1.848 N MS4A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_949954.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10179 pDONR223 100% 45.7% None 1_354del;373A>G;811_994del n/a
2 ccsbBroad304_10179 pLX_304 0% 45.7% V5 1_354del;373A>G;811_994del n/a
3 TRCN0000477106 CCATCGTGCTTAGCACGAGCATCT pLX_317 83.7% 45.7% V5 1_354del;373A>G;811_994del n/a
Download CSV