Transcript: Mouse XM_006517153.2

PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 1 (Pcsk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcsk1 (18548)
Length:
4994
CDS:
191..2452

Additional Resources:

NCBI RefSeq record:
XM_006517153.2
NBCI Gene record:
Pcsk1 (18548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221452 GCTCTCATGGACATCCTAAAT pLKO.1 2420 CDS 100% 13.200 18.480 N Pcsk1 n/a
2 TRCN0000437284 TGCGTTTGGTGTGCACTAAAC pLKO_005 239 CDS 100% 10.800 15.120 N Pcsk1 n/a
3 TRCN0000422245 AGCGCTCTTCATATCACTAAG pLKO_005 434 CDS 100% 10.800 7.560 N Pcsk1 n/a
4 TRCN0000422040 GATAATGATCATGATCCATTT pLKO_005 761 CDS 100% 10.800 7.560 N Pcsk1 n/a
5 TRCN0000221451 GCCTGAGTTGGGAATCTTCAT pLKO.1 2465 3UTR 100% 4.950 3.465 N Pcsk1 n/a
6 TRCN0000051495 GCCCTGAAAGCTAATGGAGAA pLKO.1 1622 CDS 100% 4.050 2.835 N PCSK1 n/a
7 TRCN0000221453 GCAGGTGAAATTGCCATGCAA pLKO.1 827 CDS 100% 3.000 2.100 N Pcsk1 n/a
8 TRCN0000221454 CCAATTATGATCCAGAGGCTA pLKO.1 726 CDS 100% 2.640 1.848 N Pcsk1 n/a
9 TRCN0000221455 GCATTGGATCTCTTCAATGAT pLKO.1 539 CDS 100% 0.563 0.394 N Pcsk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06696 pDONR223 100% 88.4% 92.4% None (many diffs) n/a
2 ccsbBroad304_06696 pLX_304 0% 88.4% 92.4% V5 (many diffs) n/a
3 TRCN0000469428 AAATCATTGCACGAGACTATGGAA pLX_317 19.5% 88.4% 92.4% V5 (many diffs) n/a
Download CSV