Construct: ORF BRDN0000559466
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- n/a
- Derived from:
- BRDN0000464774
- DNA Barcode:
- ATCGATTTTGTATTTGGAGGCCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- eGFP (eGFP)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-BRDN0000559466
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | CONTROL | eGFP | eGFP | Hahn Lab eGFP | eGFP.1 | 100% | 100% | |
| 2 | CONTROL | GFP | GFP | clonetechGfp | clonetechGfp.1 | 99.7% | 99.5% | 93C>T;491T>C |
| 3 | CONTROL | BFP | BFP | Hahn Lab BFP | BFP.1 | 99.1% | 98.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 786
- ORF length:
- 717
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg 121 agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc tggcgagggc gagggcgatg 181 ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct 241 ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttCAGCCGC TACCCCGACC 301 ACATGAAGCA GCACGACTTC TTCAAGTCCG CCATGCCCGA AGGCTACGTC CAGGAGCGCA 361 CCATCTTCTT CAAGGACGAC GGCAACTACA AGACCCGCGC CGAGGTGAAG TTCGAGGGCG 421 ACACCCTGGT GAACCGCATC GAGCTGAAGG GCATCGACTT CAAGGAGGAC GGCAACATCC 481 TGGGGCACAA GCTGGAGTAC AACTACAACA GCCACAACGT CTATATCATG GCCGACAAGC 541 AGAAGAACGG CATCAAGGCG AACTTCAAGA TCCGCCACAA CATCGAGGAC GGCAGCGTGC 601 AGCTCGCCGA CCACTACCAG CAGAACACCC CCATCGGCGA CGGCCCCGTG CTGCTGCCCG 661 ACAACCACTA CCTGAGCACC CAGTCCGCCC TGAGCAAAGA CCCCAACGAG AAGCGCGATC 721 ACATGGTCCT GCTGGAGTTC GTGACCGCCG CCGGGATCAC TCTCGGCATG GACGAGCTGT 781 ACAAGTCCAA GGGTGGGCGC GCCGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 841 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 901 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TCGATTTTGT 961 ATTTGGAGGC CCTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1021 att