Transcript: BFP.1

Hahn Lab blue fluorescent protein

Taxon:
Control
Gene:
BFP (BFP)
Length:
720
CDS:
1..720

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

NOTE: we do not have reliable genomic locus annotation for this transcript, so any matches reported here are computed based on available transcript RNA sequence information, including exon boundary locations. However, because we do not have intronic sequence information, we are not able to assess sequence matches at extreme exon edges.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0000561167 GGGCGAGGAGCTGTTCACCG pXPR_003 GGG 28 4% 1 0.4803 BFP, GFP, eGFP eGFP 80034
2 BRDN0000563266 GAGCTGGACGGCGACGTAAA pXPR_003 CGG 68 9% 1 0.2898 BFP, GFP, eGFP eGFP 80036
3 BRDN0000562805 GGTGCCCATCCTGGTCGAGC pXPR_003 TGG 52 7% 1 0.1012 BFP, GFP, eGFP eGFP 80035
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to BFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?] Addgene[?]
1 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 438 CDS 100% 13.200 GFP n/a
2 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_005 438 CDS 100% 13.200 GFP n/a
3 TRCN0000072193 CGACGTAAACGGCCACAAGTT pLKO.1 63 CDS 100% 4.950 GFP n/a
4 TRCN0000231761 CGACGTAAACGGCCACAAGTT pLKO_005 63 CDS 100% 4.950 GFP n/a
5 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 231 CDS 100% 4.050 GFP n/a
6 TRCN0000231762 CCACATGAAGCAGCACGACTT pLKO_005 231 CDS 100% 4.050 GFP n/a
7 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 453 CDS 100% 2.640 GFP n/a
8 TRCN0000231754 CTATATCATGGCCGACAAGCA pLKO_005 453 CDS 100% 2.640 GFP n/a
9 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 128 CDS 100% 2.640 GFP n/a
10 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_005 128 CDS 100% 2.640 GFP n/a
11 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 449 CDS 100% 2.160 GFP n/a
12 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_005 449 CDS 100% 2.160 GFP n/a
13 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 696 CDS 100% 1.650 GFP n/a
14 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_005 696 CDS 100% 1.650 GFP n/a
15 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 62 CDS 100% 1.650 GFP n/a
16 TRCN0000231755 GCGACGTAAACGGCCACAAGT pLKO_005 62 CDS 100% 1.650 GFP n/a
17 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 117 CDS 100% 1.350 GFP n/a
18 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_005 117 CDS 100% 1.350 GFP n/a
19 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 693 CDS 100% 1.350 GFP n/a
20 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_005 693 CDS 100% 1.350 GFP n/a
21 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 228 CDS 100% 0.720 GFP n/a
22 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_005 228 CDS 100% 0.720 GFP n/a
23 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 229 CDS 100% 0.720 GFP n/a
24 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_005 229 CDS 100% 0.720 GFP n/a
25 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 243 CDS 100% 0.018 GFP n/a
26 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 668 CDS 100% 0.000 GFP n/a
27 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 226 CDS 100% 0.000 GFP n/a
28 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_005 226 CDS 100% 0.000 GFP n/a
29 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 684 CDS 100% 0.000 GFP n/a
30 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_005 684 CDS 100% 0.000 GFP n/a
31 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 692 CDS 100% 0.000 GFP n/a
32 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_005 692 CDS 100% 0.000 GFP n/a
33 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 506 CDS 100% 0.000 GFP n/a
34 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_005 506 CDS 100% 0.000 GFP n/a
35 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 647 CDS 100% 0.000 GFP n/a
36 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 645 CDS 100% 0.000 GFP n/a
37 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_005 645 CDS 100% 0.000 GFP n/a
38 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 21 CDS 100% 0.000 GFP n/a
39 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 49 CDS 100% 0.000 GFP n/a
40 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 616 CDS 100% 0.000 GFP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript BFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 BRDN0000464762 pDONR223 0% 100% 100% None n/a
2 ccsbBroad301_99985 pLX_301 0% 100% 100% None n/a
3 ccsbBroad301_99987 pLX_301 0% 100% 100% None n/a
4 ccsbBroad301_99980 pLX_301 0% 100% 100% None n/a
5 ccsbBroad301_99986 pLX_301 0% 100% 100% None n/a
6 ccsbBroad304_99986 pLX_304 82.4% 100% 100% V5 n/a
7 BRDN0000464777 pLX_302 0% 100% 100% V5 n/a
8 BRDN0000559460 TAGAGATTGGGTTCAACCTGGAAG pLX_317 61.8% 100% 100% V5 n/a
9 ccsbBroad304_99985 pLX_304 72.2% 99.8% 99.5% V5 (not translated due to prior stop codon) 716A>N n/a
10 ccsbBroad304_99987 pLX_304 88.7% 99.7% 23.8% V5 (not translated due to frame shift) 99delG;116delC n/a
11 BRDN0000464763 pDONR223 0% 100% 100% None n/a
12 BRDN0000464764 pDONR223 0% 100% 100% None n/a
13 ccsbBroad301_99997 pLX_301 0% 99.1% 98.3% None (many diffs) n/a
14 ccsbBroad301_99984 pLX_301 0% 99.1% 98.3% None (many diffs) n/a
15 ccsbBroad301_99999 pLX_301 0% 99.1% 98.3% None (many diffs) n/a
16 ccsbBroad301_99998 pLX_301 0% 99.1% 98.3% None (many diffs) n/a
17 ccsbBroad304_99998 pLX_304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs) n/a
18 ccsbBroad304_99997 pLX_304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs) n/a
19 ccsbBroad304_99999 pLX_304 72.2% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs) n/a
20 BRDN0000464774 pDONR221 0% 99.1% 98.3% None (many diffs) n/a
21 BRDN0000556285 pLX_305 0% 99.1% 98.3% None (many diffs) n/a
22 BRDN0000556297 pLX_306 0% 99.1% 98.3% V5 (many diffs) n/a
23 BRDN0000556276 pLXI_401 0% 99.1% 98.3% None (many diffs) n/a
24 BRDN0000556283 pLX_311 0% 99.1% 98.3% V5 (many diffs) n/a
25 BRDN0000556281 pLX_313 0% 99.1% 98.3% V5 (many diffs) n/a
26 BRDN0000556292 pLX_314 0% 99.1% 98.3% V5 (many diffs) n/a
27 BRDN0000556298 pLX_315 0% 99.1% 98.3% V5 (many diffs) n/a
28 BRDN0000559466 ATCGATTTTGTATTTGGAGGCCCT pLX_317 70% 99.1% 98.3% V5 (many diffs) n/a
29 BRDN0000464775 pDONR221 0% 99.1% 98.3% None (many diffs) n/a
30 BRDN0000464776 pDONR221 0% 99.1% 98.3% None (many diffs) n/a
Download CSV