Transcript: eGFP.1

Hahn Lab green fluorescent protein


shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to eGFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072181 ACAACAGCCACAACGTCTATA pLKO.1 437 CDS 100% 13.200 GFP
2 TRCN0000231753 ACAACAGCCACAACGTCTATA pLKO_005 437 CDS 100% 13.200 GFP
3 TRCN0000559393 ACAACAGCCACAACGTCTATA pLKO_024 437 CDS 100% 13.200 GFP
4 TRCN0000559394 ACAACAGCCACAACGTCTATA pLKO_047 437 CDS 100% 13.200 GFP
5 TRCN0000559396 ACAACAGCCACAACGTCTATA pLKO_018 437 CDS 100% 13.200 GFP
6 TRCN0000559397 ACAACAGCCACAACGTCTATA pLKO_016 437 CDS 100% 13.200 GFP
7 TRCN0000559399 ACAACAGCCACAACGTCTATA pLKO_023 437 CDS 100% 13.200 GFP
8 TRCN0000559401 ACAACAGCCACAACGTCTATA pLKO_008 437 CDS 100% 13.200 GFP
9 TRCN0000559403 ACAACAGCCACAACGTCTATA pLKO_046 437 CDS 100% 13.200 GFP
10 TRCN0000559407 ACAACAGCCACAACGTCTATA pLKO_017 437 CDS 100% 13.200 GFP
11 TRCN0000559408 ACAACAGCCACAACGTCTATA pLKO_021 437 CDS 100% 13.200 GFP
12 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 438 CDS 100% 13.200 GFP
13 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_005 438 CDS 100% 13.200 GFP
14 TRCN0000072193 CGACGTAAACGGCCACAAGTT pLKO.1 63 CDS 100% 4.950 GFP
15 TRCN0000231761 CGACGTAAACGGCCACAAGTT pLKO_005 63 CDS 100% 4.950 GFP
16 TRCN0000072185 TACAACAGCCACAACGTCTAT pLKO.1 436 CDS 100% 4.950 GFP
17 TRCN0000231747 TACAACAGCCACAACGTCTAT pLKO_005 436 CDS 100% 4.950 GFP
18 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 231 CDS 100% 4.050 GFP
19 TRCN0000231762 CCACATGAAGCAGCACGACTT pLKO_005 231 CDS 100% 4.050 GFP
20 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 453 CDS 100% 2.640 GFP
21 TRCN0000231754 CTATATCATGGCCGACAAGCA pLKO_005 453 CDS 100% 2.640 GFP
22 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 128 CDS 100% 2.640 GFP
23 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_005 128 CDS 100% 2.640 GFP
24 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 449 CDS 100% 2.160 GFP
25 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_005 449 CDS 100% 2.160 GFP
26 TRCN0000072200 AGTACAACTACAACAGCCACA pLKO.1 428 CDS 100% 2.160 GFP
27 TRCN0000231744 AGTACAACTACAACAGCCACA pLKO_005 428 CDS 100% 2.160 GFP
28 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 696 CDS 100% 1.650 GFP
29 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_005 696 CDS 100% 1.650 GFP
30 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 62 CDS 100% 1.650 GFP
31 TRCN0000231755 GCGACGTAAACGGCCACAAGT pLKO_005 62 CDS 100% 1.650 GFP
32 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 117 CDS 100% 1.350 GFP
33 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_005 117 CDS 100% 1.350 GFP
34 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 693 CDS 100% 1.350 GFP
35 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_005 693 CDS 100% 1.350 GFP
36 TRCN0000072186 TGCCCGACAACCACTACCTGA pLKO.1 587 CDS 100% 0.880 GFP
37 TRCN0000231746 TGCCCGACAACCACTACCTGA pLKO_005 587 CDS 100% 0.880 GFP
38 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 228 CDS 100% 0.720 GFP
39 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_005 228 CDS 100% 0.720 GFP
40 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 229 CDS 100% 0.720 GFP
41 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_005 229 CDS 100% 0.720 GFP
42 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 243 CDS 100% 0.018 GFP
43 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 668 CDS 100% 0.000 GFP
44 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 226 CDS 100% 0.000 GFP
45 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_005 226 CDS 100% 0.000 GFP
46 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA pLKO.1 197 CDS 100% 0.000 GFP
47 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA pLKO_005 197 CDS 100% 0.000 GFP
48 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 684 CDS 100% 0.000 GFP
49 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_005 684 CDS 100% 0.000 GFP
50 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 692 CDS 100% 0.000 GFP
51 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_005 692 CDS 100% 0.000 GFP
52 TRCN0000207020 GACCACCCTGACCTACGGCGT pLKO.1 186 CDS 100% 0.000 GFP
53 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 506 CDS 100% 0.000 GFP
54 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_005 506 CDS 100% 0.000 GFP
55 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 647 CDS 100% 0.000 GFP
56 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 645 CDS 100% 0.000 GFP
57 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_005 645 CDS 100% 0.000 GFP
58 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 21 CDS 100% 0.000 GFP
59 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 49 CDS 100% 0.000 GFP
60 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 616 CDS 100% 0.000 GFP
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript eGFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 ccsbBroad301_99984 pLX_301 0% 100% 100% None
2 ccsbBroad301_99999 pLX_301 0% 100% 100% None
3 ccsbBroad301_99998 pLX_301 0% 100% 100% None
4 ccsbBroad301_99997 pLX_301 0% 100% 100% None
5 ccsbBroad304_99999 pLX_304 72.2% 100% 100% V5 (not translated due to frame shift)
6 ccsbBroad304_99998 pLX_304 71.7% 100% 100% V5 (not translated due to frame shift)
7 ccsbBroad304_99997 pLX_304 71.7% 100% 100% V5 (not translated due to frame shift)
8 BRDN0000464774 pDONR221 0% 100% 100% None
9 BRDN0000556285 pLX_305 0% 100% 100% None
10 BRDN0000556297 pLX_306 0% 100% 100% V5
11 BRDN0000556276 pLXI_401 0% 100% 100% None
12 BRDN0000556283 pLX_311 0% 100% 100% V5
13 BRDN0000556281 pLX_313 0% 100% 100% V5
14 BRDN0000556292 pLX_314 0% 100% 100% V5
15 BRDN0000556298 pLX_315 0% 100% 100% V5
16 BRDN0000559466 ATCGATTTTGTATTTGGAGGCCCT pLX_317 70% 100% 100% V5
17 BRDN0000464775 pDONR221 0% 100% 100% None
18 BRDN0000464776 pDONR221 0% 100% 100% None
19 BRDN0000464762 pDONR223 0% 99.1% 98.3% None (many diffs)
20 ccsbBroad301_99987 pLX_301 0% 99.1% 98.3% None (many diffs)
21 ccsbBroad301_99986 pLX_301 0% 99.1% 98.3% None (many diffs)
22 ccsbBroad301_99985 pLX_301 0% 99.1% 98.3% None (many diffs)
23 ccsbBroad301_99980 pLX_301 0% 99.1% 98.3% None (many diffs)
24 ccsbBroad304_99986 pLX_304 82.4% 99.1% 98.3% V5 (many diffs)
25 BRDN0000464777 pLX_302 0% 99.1% 98.3% V5 (many diffs)
26 BRDN0000559460 TAGAGATTGGGTTCAACCTGGAAG pLX_317 61.8% 99.1% 98.3% V5 (many diffs)
27 ccsbBroad304_99985 pLX_304 72.2% 99% 97.9% V5 (not translated due to prior stop codon) (many diffs)
28 ccsbBroad304_99987 pLX_304 88.7% 98.8% 23.5% V5 (not translated due to frame shift) (many diffs)
29 BRDN0000464763 pDONR223 0% 99.1% 98.3% None (many diffs)
30 BRDN0000464764 pDONR223 0% 99.1% 98.3% None (many diffs)
Download CSV