Construct: ORF TRCN0000465564
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010564.1_s317c1
- Derived from:
- ccsbBroadEn_08503
- DNA Barcode:
- GATCAACGCACAGCAGCTATTTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VPS53 (55275)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465564
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | NM_018289.4 | 99.9% | 100% | 1437C>T |
| 2 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | NM_001366253.2 | 95.8% | 95.8% | 286_372del;1524C>T |
| 3 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | NM_001128159.3 | 80.3% | 80% | (many diffs) |
| 4 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | XR_934062.2 | 77.6% | (many diffs) | |
| 5 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | XM_017024817.2 | 75% | 70.3% | (many diffs) |
| 6 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | NM_001366254.2 | 74.5% | 74.1% | (many diffs) |
| 7 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | XM_017024818.1 | 71.5% | 71.1% | (many diffs) |
| 8 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | XR_001752553.2 | 40.4% | (many diffs) | |
| 9 | human | 55275 | VPS53 | VPS53 subunit of GARP complex | XR_934061.3 | 19.2% | (many diffs) | |
| 10 | mouse | 68299 | Vps53 | VPS53 GARP complex subunit | NM_026664.3 | 72.1% | 77.6% | (many diffs) |
| 11 | mouse | 68299 | Vps53 | VPS53 GARP complex subunit | XM_006534052.3 | 69.1% | 74.1% | (many diffs) |
| 12 | mouse | 68299 | Vps53 | VPS53 GARP complex subunit | XM_006534053.3 | 64.2% | 68.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2076
- ORF length:
- 2010
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ggaggaggag gaactggagt tcgtggagga gctggaagcc gtgctgcagc 121 tcacgcccga ggtgcagctg gccatcgagc aggtgtttcc aagccaggac cctctagatc 181 gagcagattt caatgctgtt gagtatatca ataccctgtt cccaaccgag caatctctgg 241 cgaacataga cgaagtcgtg aacaaaatta ggctgaaaat aaggagactg gatgacaata 301 ttcgaactgt tgtaagaggt cagacgaacg tggggcagga tggacggcaa gtgaaagaaa 361 tcacccgtga tattaagcaa ttagatcacg ccaaacgcca cctgaccacc tcaatcacca 421 cactgaacca cctgcacatg ctggcaggag gtgtcgactc cctcgaagcc atgaccaggc 481 gaagacaata cggagaagtt gctaatctcc ttcagggtgt gatgaatgtc ctggagcact 541 tccacaagta tatggggatt ccgcagatcc ggcagctttc cgaaagagtg aaggctgcac 601 agactgagtt aggacagcaa atcctggcag attttgaaga agcgtttcct tcccagggca 661 ccaagagacc aggaggaccc agcaatgttc tacgagatgc atgtctggtt gctaatattc 721 tagatcccag gatcaaacag gaaatcatca aaaagtttat taaacagcat ctgtcagagt 781 atctggtact ttttcaagaa aaccaagatg ttgcctggct ggacaaaatc gacagacgct 841 atgcctggat aaaacgccag cttgtggact atgaggagaa atacggccgc atgtttccac 901 gtgagtggtg catggctgag aggattgcgg tggaattttg ccatgtgaca agggcagaac 961 ttgccaagat tatgcgtacc agagcgaagg aaattgaagt gaaattgctt ctttttgcta 1021 ttcaaagaac aactaacttt gaggggtttc ttgcaaaacg cttctccggc tgcaccctga 1081 ccgatgggac cctgaaaaag cttgagtctc cacccccatc taccaatccc ttcctggaag 1141 atgagccaac accagagatg gaggaactgg caacggagaa aggagattta gatcaaccaa 1201 agaagcctaa agccccagac aatccatttc atggcattgt ttccaagtgt tttgagcctc 1261 atctctacgt gtatatcgaa tcccaagaca agaacctcgg agagctgata gatcggtttg 1321 tggctgattt caaagcccag gggccaccta agcccaacac tgatgaaggg ggtgccgtgc 1381 tccccagctg cgccgacctc tttgtctact acaagaagtg catggtgcaa tgctctcagc 1441 tcagtactgg ggagcccatg atcgccctga ccaccatttt ccagaagtac ctccgagaat 1501 atgcctggaa aatcctctct ggcaacctgc ccaaaaccac aaccagcagt ggaggactga 1561 ctatcagcag cctcctcaag gaaaaggagg gctcagaagt agccaagttc actctggagg 1621 agctctgcct catctgtaac atcctgagca cggcagagta ctgtctggcc accacccagc 1681 agctagaaga aaaactcaaa gaaaaagtgg atgtaagtct gattgaacga atcaatctga 1741 ctggagagat ggacacgttc agcaccgtca tctccagcag tattcagctg ctggttcagg 1801 atctggatgc tgcctgtgat cctgccctga ctgccatgag caagatgcag tggcagaacg 1861 tggagcacgt tggtgaccag agcccctacg tcacctctgt cattctgcac atcaagcaga 1921 acgtccccat catccgtgac aacctggctt ccacacgcaa gtacttcact cagttcTGCG 1981 TTAAATTTGC AAACTCCTTC ATTCCCAAAT TCATCACCCA CCTCTTCAAG TGCAAGCCAA 2041 TTAGCATGGT GGGAGCAGAA CAGGTGAGAT GGACGTACCC AACTTTCTTG TACAAAGTGG 2101 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 2161 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 2221 AGATCAACGC ACAGCAGCTA TTTCCACGCG TTAAGTCgac aatcaacctc tggattacaa 2281 aatttgtgaa agatt