Transcript: Human NM_001128159.3

Homo sapiens VPS53 subunit of GARP complex (VPS53), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
VPS53 (55275)
Length:
13089
CDS:
131..2629

Additional Resources:

NCBI RefSeq record:
NM_001128159.3
NBCI Gene record:
VPS53 (55275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429051 AGCAATCTCTGGCGAACATAG pLKO_005 294 CDS 100% 10.800 15.120 N VPS53 n/a
2 TRCN0000146547 CACTCAGTTCTGCGTTAAATT pLKO.1 2119 CDS 100% 15.000 12.000 N VPS53 n/a
3 TRCN0000420512 ACCGTCATCTCCAGCAGTATT pLKO_005 1916 CDS 100% 13.200 9.240 N VPS53 n/a
4 TRCN0000434828 ATGCTGTTGAGTATATCAATA pLKO_005 258 CDS 100% 13.200 9.240 N VPS53 n/a
5 TRCN0000180068 CCAGAAGTACCTCCGAGAATA pLKO.1 1633 CDS 100% 13.200 9.240 N VPS53 n/a
6 TRCN0000148029 GAAAGAAATCACCCGTGATAT pLKO.1 505 CDS 100% 13.200 9.240 N VPS53 n/a
7 TRCN0000148267 GATCAACCAAAGAAGCCTAAA pLKO.1 1343 CDS 100% 10.800 7.560 N VPS53 n/a
8 TRCN0000418907 GATGCATGTCTGGTTGCTAAT pLKO_005 848 CDS 100% 10.800 7.560 N VPS53 n/a
9 TRCN0000180508 GAGCCTCATCTCTACGTGTAT pLKO.1 1406 CDS 100% 4.950 3.465 N VPS53 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5673 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5674 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5277 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08503 pDONR223 100% 80.3% 80% None (many diffs) n/a
2 ccsbBroad304_08503 pLX_304 0% 80.3% 80% V5 (many diffs) n/a
3 TRCN0000465564 GATCAACGCACAGCAGCTATTTCC pLX_317 5.4% 80.3% 80% V5 (many diffs) n/a
4 ccsbBroadEn_12195 pDONR223 100% 16.6% 16.4% None (many diffs) n/a
5 ccsbBroad304_12195 pLX_304 0% 16.6% 16.4% V5 (many diffs) n/a
6 TRCN0000469159 GATCTGTTTCGGGCACTAATAATT pLX_317 85% 16.6% 16.4% V5 (many diffs) n/a
Download CSV