Transcript: Human XM_017024818.1

PREDICTED: Homo sapiens VPS53 subunit of GARP complex (VPS53), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS53 (55275)
Length:
8792
CDS:
758..2887

Additional Resources:

NCBI RefSeq record:
XM_017024818.1
NBCI Gene record:
VPS53 (55275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146547 CACTCAGTTCTGCGTTAAATT pLKO.1 2377 CDS 100% 15.000 12.000 N VPS53 n/a
2 TRCN0000420512 ACCGTCATCTCCAGCAGTATT pLKO_005 2174 CDS 100% 13.200 9.240 N VPS53 n/a
3 TRCN0000180068 CCAGAAGTACCTCCGAGAATA pLKO.1 1891 CDS 100% 13.200 9.240 N VPS53 n/a
4 TRCN0000148029 GAAAGAAATCACCCGTGATAT pLKO.1 763 CDS 100% 13.200 9.240 N VPS53 n/a
5 TRCN0000148267 GATCAACCAAAGAAGCCTAAA pLKO.1 1601 CDS 100% 10.800 7.560 N VPS53 n/a
6 TRCN0000418907 GATGCATGTCTGGTTGCTAAT pLKO_005 1106 CDS 100% 10.800 7.560 N VPS53 n/a
7 TRCN0000180508 GAGCCTCATCTCTACGTGTAT pLKO.1 1664 CDS 100% 4.950 3.465 N VPS53 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5931 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000074714 CCACAAGTTGAGAGAGTGTCT pLKO.1 107 5UTR 100% 2.640 1.320 Y RPS4X n/a
10 TRCN0000289170 CCACAAGTTGAGAGAGTGTCT pLKO_005 107 5UTR 100% 2.640 1.320 Y RPS4X n/a
11 TRCN0000074716 GCTGGATAAATTGACCGGTGT pLKO.1 59 5UTR 100% 2.160 1.080 Y RPS4X n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5932 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5535 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08503 pDONR223 100% 71.5% 71.1% None (many diffs) n/a
2 ccsbBroad304_08503 pLX_304 0% 71.5% 71.1% V5 (many diffs) n/a
3 TRCN0000465564 GATCAACGCACAGCAGCTATTTCC pLX_317 5.4% 71.5% 71.1% V5 (many diffs) n/a
4 ccsbBroadEn_12195 pDONR223 100% 19.5% 19.3% None (many diffs) n/a
5 ccsbBroad304_12195 pLX_304 0% 19.5% 19.3% V5 (many diffs) n/a
6 TRCN0000469159 GATCTGTTTCGGGCACTAATAATT pLX_317 85% 19.5% 19.3% V5 (many diffs) n/a
Download CSV