Transcript: Mouse XM_006534052.3

PREDICTED: Mus musculus VPS53 GARP complex subunit (Vps53), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vps53 (68299)
Length:
2653
CDS:
93..2516

Additional Resources:

NCBI RefSeq record:
XM_006534052.3
NBCI Gene record:
Vps53 (68299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175224 CGAGATATTAAGCAGTTAGAT pLKO.1 405 CDS 100% 5.625 4.500 N Vps53 n/a
2 TRCN0000219555 GAGCCTGACTGAACGAATTAA pLKO.1 1754 CDS 100% 15.000 10.500 N Vps53 n/a
3 TRCN0000340952 GAGCCTGACTGAACGAATTAA pLKO_005 1754 CDS 100% 15.000 10.500 N Vps53 n/a
4 TRCN0000219554 GCGTGCCTGGTGGCTAATATT pLKO.1 738 CDS 100% 15.000 10.500 N Vps53 n/a
5 TRCN0000340950 GCGTGCCTGGTGGCTAATATT pLKO_005 738 CDS 100% 15.000 10.500 N Vps53 n/a
6 TRCN0000180068 CCAGAAGTACCTCCGAGAATA pLKO.1 1520 CDS 100% 13.200 9.240 N VPS53 n/a
7 TRCN0000173756 CCTGCCAGTTACACTAAGATT pLKO.1 2181 CDS 100% 5.625 3.938 N Vps53 n/a
8 TRCN0000173293 GCCAGAGCTAAGGAAATTGAA pLKO.1 1017 CDS 100% 5.625 3.938 N Vps53 n/a
9 TRCN0000340875 GCCAGAGCTAAGGAAATTGAA pLKO_005 1017 CDS 100% 5.625 3.938 N Vps53 n/a
10 TRCN0000340953 GCATGGCCAGAGTCCTGAACA pLKO_005 2528 3UTR 100% 1.650 1.155 N Vps53 n/a
11 TRCN0000180508 GAGCCTCATCTCTACGTGTAT pLKO.1 1293 CDS 100% 4.950 3.960 N VPS53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08503 pDONR223 100% 69.1% 74.1% None (many diffs) n/a
2 ccsbBroad304_08503 pLX_304 0% 69.1% 74.1% V5 (many diffs) n/a
3 TRCN0000465564 GATCAACGCACAGCAGCTATTTCC pLX_317 5.4% 69.1% 74.1% V5 (many diffs) n/a
4 ccsbBroadEn_12195 pDONR223 100% 15.1% 16.1% None (many diffs) n/a
5 ccsbBroad304_12195 pLX_304 0% 15.1% 16.1% V5 (many diffs) n/a
6 TRCN0000469159 GATCTGTTTCGGGCACTAATAATT pLX_317 85% 15.1% 16.1% V5 (many diffs) n/a
Download CSV