Transcript: Mouse XM_006503349.3

PREDICTED: Mus musculus spermatogenesis associated 6 (Spata6), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata6 (67946)
Length:
2702
CDS:
1140..1931

Additional Resources:

NCBI RefSeq record:
XM_006503349.3
NBCI Gene record:
Spata6 (67946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503349.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216787 GAGTTGAACCCAGCATATTTC pLKO.1 2042 3UTR 100% 13.200 18.480 N Spata6 n/a
2 TRCN0000248454 ACTACGAACAGCCTACGATTT pLKO_005 1078 5UTR 100% 10.800 8.640 N Spata6 n/a
3 TRCN0000248457 TGAGATCCATGACCGGGTAAA pLKO_005 1595 CDS 100% 10.800 8.640 N Spata6 n/a
4 TRCN0000190698 GCAGCCTCTTGTAAAGGGAAA pLKO.1 1812 CDS 100% 4.050 3.240 N Spata6 n/a
5 TRCN0000216551 GTCATTCATGTAGCTAATATT pLKO.1 2547 3UTR 100% 15.000 10.500 N Spata6 n/a
6 TRCN0000248455 GTCATTCATGTAGCTAATATT pLKO_005 2547 3UTR 100% 15.000 10.500 N Spata6 n/a
7 TRCN0000248453 AGTCACCCGAGAGGAGTAAAT pLKO_005 1039 5UTR 100% 13.200 9.240 N Spata6 n/a
8 TRCN0000192068 CACAGCGATCATCCTCATATT pLKO.1 1326 CDS 100% 13.200 9.240 N Spata6 n/a
9 TRCN0000061811 CCTCCATTTGTGATTAGACAT pLKO.1 1224 CDS 100% 4.950 2.970 N SPATA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503349.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12060 pDONR223 100% 45% 43.8% None (many diffs) n/a
2 ccsbBroad304_12060 pLX_304 0% 45% 43.8% V5 (many diffs) n/a
3 TRCN0000465803 ATGTTGCTTGATGAAGCCAGGCTC pLX_317 23.8% 45% 43.8% V5 (many diffs) n/a
Download CSV