Transcript: Human XM_005264468.2

PREDICTED: Homo sapiens RAB1A, member RAS oncogene family (RAB1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB1A (5861)
Length:
2378
CDS:
218..739

Additional Resources:

NCBI RefSeq record:
XM_005264468.2
NBCI Gene record:
RAB1A (5861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381178 AGCGAAGGAATTTGCTGATTC pLKO_005 535 CDS 100% 10.800 15.120 N RAB1A n/a
2 TRCN0000422136 GAGATTGTAAATGGTCAATAC pLKO_005 868 3UTR 100% 10.800 15.120 N Rab1a n/a
3 TRCN0000157318 CCAGTGCTAAGAATGCAACGA pLKO.1 579 CDS 100% 2.640 3.696 N RAB1A n/a
4 TRCN0000297880 CCAGTGCTAAGAATGCAACGA pLKO_005 579 CDS 100% 2.640 3.696 N RAB1A n/a
5 TRCN0000100862 GAAAGCTACATCAGCACAATT pLKO.1 329 CDS 100% 13.200 9.240 N Rab1a n/a
6 TRCN0000380201 TGCTGAGAAGTCCAATGTTAA pLKO_005 673 CDS 100% 13.200 9.240 N RAB1A n/a
7 TRCN0000150837 GCATCCAGTATTTGCTTTCTA pLKO.1 1488 3UTR 100% 5.625 3.938 N RAB1A n/a
8 TRCN0000157760 CCCTTGACTCAAGACAGCTAA pLKO.1 905 3UTR 100% 4.950 3.465 N RAB1A n/a
9 TRCN0000280677 CCCTTGACTCAAGACAGCTAA pLKO_005 905 3UTR 100% 4.950 3.465 N RAB1A n/a
10 TRCN0000151640 CTTCTTAGGTTTGCAGATGAT pLKO.1 299 CDS 100% 4.950 3.465 N RAB1A n/a
11 TRCN0000297879 CTTCTTAGGTTTGCAGATGAT pLKO_005 299 CDS 100% 4.950 3.465 N RAB1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01357 pDONR223 100% 84.3% 84.3% None 192_193ins96 n/a
2 ccsbBroad304_01357 pLX_304 0% 84.3% 84.3% V5 192_193ins96 n/a
3 TRCN0000466775 CTTCGATGTAGACACAACAGCAAG pLX_317 62.2% 84.3% 84.3% V5 192_193ins96 n/a
4 ccsbBroadEn_04261 pDONR223 100% 63.2% 76% None (many diffs) n/a
5 ccsbBroad304_04261 pLX_304 0% 63.2% 76% V5 (many diffs) n/a
6 TRCN0000465917 TCTGCGTGGACTTTCAGGGTCAGA pLX_317 52.8% 63.2% 76% V5 (many diffs) n/a
Download CSV