Construct: ORF TRCN0000466138
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011207.1_s317c1
- Derived from:
- ccsbBroadEn_13577
- DNA Barcode:
- GGGCTTTAAACGAACATAAGAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBAC2 (337867)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466138
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 337867 | UBAC2 | UBA domain containing 2 | XM_006719948.3 | 100% | 100% | |
| 2 | human | 337867 | UBAC2 | UBA domain containing 2 | XM_011521083.2 | 76.3% | 72.8% | (many diffs) |
| 3 | human | 337867 | UBAC2 | UBA domain containing 2 | XM_017020553.1 | 74.1% | 67.7% | (many diffs) |
| 4 | human | 337867 | UBAC2 | UBA domain containing 2 | NM_177967.4 | 72.1% | 68.8% | (many diffs) |
| 5 | human | 337867 | UBAC2 | UBA domain containing 2 | XM_011521082.2 | 70.3% | 67.1% | (many diffs) |
| 6 | human | 337867 | UBAC2 | UBA domain containing 2 | NM_001144072.2 | 67.1% | 67.1% | 1_339del |
| 7 | human | 337867 | UBAC2 | UBA domain containing 2 | NR_026644.2 | 24% | 1_1022del;1716_2887del | |
| 8 | mouse | 68889 | Ubac2 | ubiquitin associated domain... | XM_006519493.3 | 59.4% | 59.4% | (many diffs) |
| 9 | mouse | 68889 | Ubac2 | ubiquitin associated domain... | NM_026861.2 | 57.5% | 58.5% | (many diffs) |
| 10 | mouse | 68889 | Ubac2 | ubiquitin associated domain... | XM_006519492.2 | 53.4% | 54.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 762
- ORF length:
- 693
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcagtatttc tttggcatca ctgcagctag taatttgcct tctggattcc 121 tggcacctgt gtttgctctg tttgtaccat tttactgctc cataccaaga gtccaagtgg 181 cacaaattct gggtccgttg tccatcacaa acaagacatt gatttatata ttgggactgc 241 agcttttcac ctctggttcc tacatctgga ttgtagccat aagtggactt atgtccggtc 301 tgtgctacga cagcaaaatg ttccaggtgc atcaggtgct ctgcatcccc agctggatgg 361 caaaattctt ttcttggaca cttgaaccca TCTTCTCTTC TTCAGAACCC ACCAGCGAAG 421 CCAGAATTGG GATGGGAGCC ACGCTGGACA TCCAGAGACA GCAGAGAATG GAGCTGCTGG 481 ACCGGCAGCT GATGTTCTCT CAGTTTGCAC AAGGGAGGCG ACAGAGACAG CAGCAGGGAG 541 GAATGATCAA TTGGAATCGT CTTTTTCCTC CTTTACGTCA GCGACAAAAC GTAAACTATC 601 AGGGCGGTCG GCAGTCTGAG CCAGCAGCGC CCCCTCTAGA AGTTTCTGAG GAACAGGTCG 661 CCCGGCTCAT GGAGATGGGA TTTTCCAGAG GTGATGCTTT GGAAGCCCTG AGAGCTTCAA 721 ACAATGACCT CAATGTCGCC ACCAACTTCC TGCTGCAGCA CTTGCCAACT TTCTTGTACA 781 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 841 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 901 AGGACGAGGG CTTTAAACGA ACATAAGAAT CACGCGTTAA GTCgacaatc aacctctgga 961 ttacaaaatt tgtgaaagat t