Transcript: Human XM_006719948.3

PREDICTED: Homo sapiens UBA domain containing 2 (UBAC2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBAC2 (337867)
Length:
2323
CDS:
534..1229

Additional Resources:

NCBI RefSeq record:
XM_006719948.3
NBCI Gene record:
UBAC2 (337867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229615 CCATGAAACTTGGGTTAATTT pLKO_005 1838 3UTR 100% 15.000 10.500 N UBAC2 n/a
2 TRCN0000229614 AGCAGGGAGGAATGATCAATT pLKO_005 997 CDS 100% 13.200 9.240 N UBAC2 n/a
3 TRCN0000254388 AGCAGGGAGGAATGATCAATT pLKO_005 997 CDS 100% 13.200 9.240 N Ubac2 n/a
4 TRCN0000229613 CATCTGGATTGTAGCCATAAG pLKO_005 728 CDS 100% 10.800 7.560 N UBAC2 n/a
5 TRCN0000218399 CTTCAAACAATGACCTCAATG pLKO_005 1180 CDS 100% 10.800 7.560 N UBAC2 n/a
6 TRCN0000229612 TTTGCTCTGTTTGTACCATTT pLKO_005 597 CDS 100% 10.800 7.560 N UBAC2 n/a
7 TRCN0000007782 GCAGCTGATGTTCTCTCAGTT pLKO.1 950 CDS 100% 4.950 3.465 N UBAC2 n/a
8 TRCN0000007781 GCTTTCAAGTGGAGGGAAGTT pLKO.1 129 5UTR 100% 4.950 3.465 N UBAC2 n/a
9 TRCN0000007778 GCCATTACATTAGCATGTATT pLKO.1 1411 3UTR 100% 1.320 0.924 N UBAC2 n/a
10 TRCN0000007780 GCACCTGTGTTTGCTCTGTTT pLKO.1 588 CDS 100% 4.950 2.970 N UBAC2 n/a
11 TRCN0000007779 GCTTCAAACAATGACCTCAAT pLKO.1 1179 CDS 100% 4.950 2.970 N UBAC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13577 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13577 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466138 GGGCTTTAAACGAACATAAGAATC pLX_317 53.3% 100% 100% V5 n/a
4 ccsbBroadEn_13576 pDONR223 100% 67.9% 67.9% None 1_222del n/a
5 ccsbBroad304_13576 pLX_304 0% 67.9% 67.9% V5 1_222del n/a
6 TRCN0000469466 GACCATCATCATCTAGAATTTCAG pLX_317 77.8% 67.9% 67.9% V5 1_222del n/a
Download CSV