Transcript: Mouse XM_006519492.2

PREDICTED: Mus musculus ubiquitin associated domain containing 2 (Ubac2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubac2 (68889)
Length:
2156
CDS:
189..1178

Additional Resources:

NCBI RefSeq record:
XM_006519492.2
NBCI Gene record:
Ubac2 (68889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254389 TTTACGTCAGCGACGAAATAT pLKO_005 983 CDS 100% 15.000 21.000 N Ubac2 n/a
2 TRCN0000254386 TGTAGTGGTCTTCTCATTTAT pLKO_005 402 CDS 100% 15.000 10.500 N Ubac2 n/a
3 TRCN0000254387 TTGCCGTGTAGTATCAAATAA pLKO_005 1308 3UTR 100% 15.000 10.500 N Ubac2 n/a
4 TRCN0000229614 AGCAGGGAGGAATGATCAATT pLKO_005 943 CDS 100% 13.200 7.920 N UBAC2 n/a
5 TRCN0000254388 AGCAGGGAGGAATGATCAATT pLKO_005 943 CDS 100% 13.200 7.920 N Ubac2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13577 pDONR223 100% 53.4% 54.2% None (many diffs) n/a
2 ccsbBroad304_13577 pLX_304 0% 53.4% 54.2% V5 (many diffs) n/a
3 TRCN0000466138 GGGCTTTAAACGAACATAAGAATC pLX_317 53.3% 53.4% 54.2% V5 (many diffs) n/a
4 ccsbBroadEn_13576 pDONR223 100% 40.8% 41% None (many diffs) n/a
5 ccsbBroad304_13576 pLX_304 0% 40.8% 41% V5 (many diffs) n/a
6 TRCN0000469466 GACCATCATCATCTAGAATTTCAG pLX_317 77.8% 40.8% 41% V5 (many diffs) n/a
Download CSV