Transcript: Human NM_177967.4

Homo sapiens UBA domain containing 2 (UBAC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
UBAC2 (337867)
Length:
2657
CDS:
559..1488

Additional Resources:

NCBI RefSeq record:
NM_177967.4
NBCI Gene record:
UBAC2 (337867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177967.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229615 CCATGAAACTTGGGTTAATTT pLKO_005 2097 3UTR 100% 15.000 10.500 N UBAC2 n/a
2 TRCN0000229614 AGCAGGGAGGAATGATCAATT pLKO_005 1256 CDS 100% 13.200 9.240 N UBAC2 n/a
3 TRCN0000254388 AGCAGGGAGGAATGATCAATT pLKO_005 1256 CDS 100% 13.200 9.240 N Ubac2 n/a
4 TRCN0000229613 CATCTGGATTGTAGCCATAAG pLKO_005 987 CDS 100% 10.800 7.560 N UBAC2 n/a
5 TRCN0000218399 CTTCAAACAATGACCTCAATG pLKO_005 1439 CDS 100% 10.800 7.560 N UBAC2 n/a
6 TRCN0000229612 TTTGCTCTGTTTGTACCATTT pLKO_005 856 CDS 100% 10.800 7.560 N UBAC2 n/a
7 TRCN0000007782 GCAGCTGATGTTCTCTCAGTT pLKO.1 1209 CDS 100% 4.950 3.465 N UBAC2 n/a
8 TRCN0000007781 GCTTTCAAGTGGAGGGAAGTT pLKO.1 618 CDS 100% 4.950 3.465 N UBAC2 n/a
9 TRCN0000007778 GCCATTACATTAGCATGTATT pLKO.1 1670 3UTR 100% 1.320 0.924 N UBAC2 n/a
10 TRCN0000007780 GCACCTGTGTTTGCTCTGTTT pLKO.1 847 CDS 100% 4.950 2.970 N UBAC2 n/a
11 TRCN0000007779 GCTTCAAACAATGACCTCAAT pLKO.1 1438 CDS 100% 4.950 2.970 N UBAC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177967.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13577 pDONR223 100% 72.1% 68.8% None (many diffs) n/a
2 ccsbBroad304_13577 pLX_304 0% 72.1% 68.8% V5 (many diffs) n/a
3 TRCN0000466138 GGGCTTTAAACGAACATAAGAATC pLX_317 53.3% 72.1% 68.8% V5 (many diffs) n/a
4 ccsbBroadEn_13576 pDONR223 100% 50.8% 50.8% None 1_456del n/a
5 ccsbBroad304_13576 pLX_304 0% 50.8% 50.8% V5 1_456del n/a
6 TRCN0000469466 GACCATCATCATCTAGAATTTCAG pLX_317 77.8% 50.8% 50.8% V5 1_456del n/a
Download CSV