Construct: ORF TRCN0000466157
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010160.1_s317c1
- Derived from:
- ccsbBroadEn_15444
- DNA Barcode:
- AACATCTTCCGGACGCACAACCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-C (3107)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466157
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 99.1% | 99.1% | 1_9delATGCGGGTC |
| 2 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 98.9% | 98.6% | 1_9delATGCGGGTC;270C>G;368A>C |
| 3 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 90.6% | 84.9% | (many diffs) |
| 4 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 88.2% | 80.8% | (many diffs) |
| 5 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 87.8% | 79.5% | (many diffs) |
| 6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 84.3% | 74.6% | (many diffs) |
| 7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 83.1% | 74.3% | (many diffs) |
| 8 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 82.3% | 74.3% | (many diffs) |
| 9 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 81.3% | 73.2% | (many diffs) |
| 10 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 81.2% | 73.4% | (many diffs) |
| 11 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 81.2% | 73.4% | (many diffs) |
| 12 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 80.1% | 72.5% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 78.2% | 69.8% | (many diffs) |
| 14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 76% | 61.2% | (many diffs) |
| 15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 76% | 61.2% | (many diffs) |
| 16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 74.3% | 64.5% | (many diffs) |
| 17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 72% | 60% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 70.7% | 61.3% | (many diffs) |
| 19 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 69.9% | 62.3% | (many diffs) |
| 20 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 59.5% | 52.6% | (many diffs) |
| 21 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 58.9% | 52.7% | (many diffs) |
| 22 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 58.9% | 52.7% | (many diffs) |
| 23 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 57.2% | (many diffs) | |
| 24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 55.1% | 49.8% | (many diffs) |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 48.3% | 41.3% | (many diffs) |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 29.1% | (many diffs) | |
| 27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 28% | (many diffs) | |
| 28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 27.6% | (many diffs) | |
| 29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 15.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1155
- ORF length:
- 1089
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gccccgagcc ctcctcctgc tgctctcggg aggcctggcc ctgaccgaga 121 cctgggcctg ctcccactcc atgaggtatt tcgacaccgc cgtgtcccgg cccggccgcg 181 gagagccccg cttcatctca gtgggctacg tggacgacac gcagttcgtg cggttcgaca 241 gcgacgccgc gagtccgaga ggggagccgc gggcgccgtg ggtggagcag gaggggccgg 301 agtattggga ccgggagaca cagaagtaca agcgccaggc acaggctgac cgagtgagcc 361 tgcggaacct gcgcggctac tacaaccaga gcgaggacgg gtctcacacc ctccagagga 421 tgtctggctg cgacctgggg cccgacgggc gcctcctccg cgggtatgac cagtccgcct 481 acgacggcaa ggattacatc gccctgaacg aggacctgcg ctcctggacc gccgcggaca 541 ccgcggctca gatcacccag cgcaagttgg aggcggcccg tgcggcggag cagctgagag 601 cctacctgga gggcacgtgc gtggagtggc tccgcagata cctggagaac gggaaggaga 661 cgctgcagcg cgcagaaccc ccaaagacac acgtgaccca ccaccccctc tctgaccatg 721 aggccaccct gaggtgctgg gccctgggct tctaccctgc ggagatcaca ctgacctggc 781 agcgggatgg gGAGGACCAG ACCCAGGACA CCGAGCTTGT GGAGACCAGG CCAGCAGGAG 841 ATGGAACCTT CCAGAAGTGG GCAGCTGTGG TGGTGCCTTC TGGACAAGAG CAGAGATACA 901 CGTGCCATAT GCAGCACGAG GGGCTGCAAG AGCCCCTCAC CCTGAGCTGG GAGCCATCTT 961 CCCAGCCCAC CATCCCCATC ATGGGCATCG TTGCTGGCCT GGCTGTCCTG GTTGTCCTAG 1021 CTGTCCTTGG AGCTGTGGTC ACCGCTATGA TGTGTAGGAG GAAGAGCTCA GGTGGAAAAG 1081 GAGGGAGCTG CTCTCAGGCT GCGTGCAGCA ACAGTGCCCA GGGCTCTGAT GAGTCTCTCA 1141 TCACTTGTAA AGCCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AACATCTTCC GGACGCACAA 1321 CCGTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt