Transcript: Human XR_001743374.1

PREDICTED: Homo sapiens major histocompatibility complex, class I, F (HLA-F), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HLA-F (3134)
Length:
3364
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743374.1
NBCI Gene record:
HLA-F (3134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057267 GAGTACGTAGACGACACGCAA pLKO.1 169 3UTR 100% 2.640 3.696 N HLA-F n/a
2 TRCN0000299009 GAGTACGTAGACGACACGCAA pLKO_005 169 3UTR 100% 2.640 3.696 N HLA-F n/a
3 TRCN0000057264 AGAGGAATATGCAGAGGAGTT pLKO.1 540 3UTR 100% 4.050 2.835 N HLA-F n/a
4 TRCN0000299008 AGAGGAATATGCAGAGGAGTT pLKO_005 540 3UTR 100% 4.050 2.835 N HLA-F n/a
5 TRCN0000057263 AGATAGAAACAGAGGGAGCTA pLKO.1 1032 3UTR 100% 2.640 1.848 N HLA-F n/a
6 TRCN0000057266 CGCAGTATTGGGAGTGGACCA pLKO.1 263 3UTR 100% 0.720 0.504 N HLA-F n/a
7 TRCN0000057265 CCAGGGAATGAATGGCTGCGA pLKO.1 378 3UTR 100% 0.220 0.154 N HLA-F n/a
8 TRCN0000299007 CCAGGGAATGAATGGCTGCGA pLKO_005 378 3UTR 100% 0.220 0.154 N HLA-F n/a
9 TRCN0000294488 TCCGCAGATACTTGGAGAATG pLKO_005 596 3UTR 100% 10.800 6.480 N HLA-F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06377 pDONR223 100% 37% None (many diffs) n/a
2 ccsbBroad304_06377 pLX_304 0% 37% V5 (many diffs) n/a
3 TRCN0000468057 TTATGCCGCCCGGCTCAGACGATT pLX_317 25.1% 37% V5 (many diffs) n/a
4 ccsbBroadEn_06378 pDONR223 100% 30.7% None (many diffs) n/a
5 ccsbBroad304_06378 pLX_304 0% 30.7% V5 (many diffs) n/a
6 TRCN0000469084 CCGCATGATACGGACCGACTTCAA pLX_317 36.9% 30.7% V5 (many diffs) n/a
7 ccsbBroadEn_10873 pDONR223 100% 28.2% None (many diffs) n/a
8 ccsbBroad304_10873 pLX_304 0% 28.2% V5 (many diffs) n/a
9 TRCN0000467519 TAGATAGCAAGTTGAAAACATAGT pLX_317 37.4% 28.2% V5 (many diffs) n/a
10 ccsbBroadEn_15443 pDONR223 0% 28% None (many diffs) n/a
11 ccsbBroad304_15443 pLX_304 0% 28% V5 (many diffs) n/a
12 TRCN0000474782 GACCCAGCCTCAGCGGGTCATATA pLX_317 48.2% 28% V5 (many diffs) n/a
13 ccsbBroad304_13869 pLX_304 38.8% 28% V5 (many diffs) n/a
14 TRCN0000478257 GCGAGGCAGAGTCGTTTTGCCCGA pLX_317 25.5% 28% V5 (many diffs) n/a
15 ccsbBroadEn_13869 pDONR223 100% 27.9% None (many diffs) n/a
16 ccsbBroadEn_15444 pDONR223 0% 28% None (many diffs) n/a
17 ccsbBroad304_15444 pLX_304 0% 28% V5 (many diffs) n/a
18 TRCN0000466157 AACATCTTCCGGACGCACAACCGT pLX_317 33.7% 28% V5 (many diffs) n/a
19 ccsbBroadEn_10874 pDONR223 100% 27.9% None (many diffs) n/a
20 ccsbBroad304_10874 pLX_304 0% 27.9% V5 (many diffs) n/a
21 TRCN0000466537 CCTTGTCTCTTTAGTTCCGGAATC pLX_317 24.9% 27.9% V5 (many diffs) n/a
22 ccsbBroadEn_10876 pDONR223 100% 27.9% None (many diffs) n/a
23 ccsbBroad304_10876 pLX_304 0% 27.9% V5 (many diffs) n/a
24 TRCN0000480126 GGTTTAAAAAATATATTGATCTAG pLX_317 37.2% 27.9% V5 (many diffs) n/a
25 ccsbBroadEn_10875 pDONR223 100% 27.7% None (many diffs) n/a
26 ccsbBroad304_10875 pLX_304 0% 27.7% V5 (many diffs) n/a
27 TRCN0000469854 ACACCGAACACAATGTCGCAAGTA pLX_317 39.8% 27.7% V5 (many diffs) n/a
28 ccsbBroadEn_06379 pDONR223 100% 26.1% None (many diffs) n/a
29 ccsbBroad304_06379 pLX_304 0% 26.1% V5 (many diffs) n/a
30 TRCN0000465566 TATGGTTATTATAGCAGACTCGAC pLX_317 34% 26.1% V5 (many diffs) n/a
31 ccsbBroadEn_10885 pDONR223 100% 9.4% None (many diffs) n/a
32 ccsbBroad304_10885 pLX_304 0% 9.4% V5 (many diffs) n/a
33 TRCN0000480644 ACTGTGAATCATTCCCGCTCGGTA pLX_317 62.4% 9.3% V5 (many diffs) n/a
Download CSV