Transcript: Human NM_001363567.1

Homo sapiens major histocompatibility complex, class I, G (HLA-G), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
HLA-G (3135)
Length:
1475
CDS:
61..1092

Additional Resources:

NCBI RefSeq record:
NM_001363567.1
NBCI Gene record:
HLA-G (3135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057273 CGGCCAATGTGGCTGAACAAA pLKO.1 593 CDS 100% 5.625 3.938 N HLA-G n/a
2 TRCN0000057274 CCACCCTGTCTTTGACTATGA pLKO.1 720 CDS 100% 4.950 3.465 N HLA-G n/a
3 TRCN0000057276 TATGAACAGTATGCCTACGAT pLKO.1 484 CDS 100% 3.000 2.100 N HLA-G n/a
4 TRCN0000057275 GACTGACAGAATGAACCTGCA pLKO.1 363 CDS 100% 2.160 1.512 N HLA-G n/a
5 TRCN0000436600 ACTGCGGCTCAGATCTCCAAG pLKO_005 559 CDS 100% 1.350 0.945 N HLA-G n/a
6 TRCN0000426504 ACTGAGTGGCAAGTCCCTTTG pLKO_005 1145 3UTR 100% 6.000 3.600 N HLA-G n/a
7 TRCN0000057277 CTGGTTGTCCTTGCAGCTGTA pLKO.1 1018 CDS 100% 4.050 2.430 N HLA-G n/a
8 TRCN0000057315 GCAGAGATACACGTGCCATAT pLKO.1 909 CDS 100% 10.800 5.400 Y HLA-C n/a
9 TRCN0000363747 GCAGAGATACACGTGCCATAT pLKO_005 909 CDS 100% 10.800 5.400 Y HLA-C n/a
10 TRCN0000057341 CCACTCCATGAGGTATTTCTA pLKO.1 153 CDS 100% 5.625 2.813 Y HLA-B n/a
11 TRCN0000057241 CCACTCCATGAGGTATTTCTT pLKO.1 153 CDS 100% 5.625 2.813 Y HLA-A n/a
12 TRCN0000299015 CCACTCCATGAGGTATTTCTT pLKO_005 153 CDS 100% 5.625 2.813 Y HLA-A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06379 pDONR223 100% 97.6% 97.6% None (many diffs) n/a
2 ccsbBroad304_06379 pLX_304 0% 97.6% 97.6% V5 (many diffs) n/a
3 TRCN0000465566 TATGGTTATTATAGCAGACTCGAC pLX_317 34% 97.6% 97.6% V5 (many diffs) n/a
4 ccsbBroadEn_06378 pDONR223 100% 82.3% 75.1% None (many diffs) n/a
5 ccsbBroad304_06378 pLX_304 0% 82.3% 75.1% V5 (many diffs) n/a
6 TRCN0000469084 CCGCATGATACGGACCGACTTCAA pLX_317 36.9% 82.3% 75.1% V5 (many diffs) n/a
7 ccsbBroad304_13869 pLX_304 38.8% 81.6% 73.7% V5 (many diffs) n/a
8 TRCN0000478257 GCGAGGCAGAGTCGTTTTGCCCGA pLX_317 25.5% 81.6% 73.7% V5 (many diffs) n/a
9 ccsbBroadEn_13869 pDONR223 100% 81.3% 72.7% None (many diffs) n/a
10 ccsbBroadEn_15443 pDONR223 0% 81.4% 73.7% None (many diffs) n/a
11 ccsbBroad304_15443 pLX_304 0% 81.4% 73.7% V5 (many diffs) n/a
12 TRCN0000474782 GACCCAGCCTCAGCGGGTCATATA pLX_317 48.2% 81.4% 73.7% V5 (many diffs) n/a
13 ccsbBroadEn_10876 pDONR223 100% 81.4% 75.7% None (many diffs) n/a
14 ccsbBroad304_10876 pLX_304 0% 81.4% 75.7% V5 (many diffs) n/a
15 TRCN0000480126 GGTTTAAAAAATATATTGATCTAG pLX_317 37.2% 81.4% 75.7% V5 (many diffs) n/a
16 ccsbBroadEn_10874 pDONR223 100% 81.2% 73.5% None (many diffs) n/a
17 ccsbBroad304_10874 pLX_304 0% 81.2% 73.5% V5 (many diffs) n/a
18 TRCN0000466537 CCTTGTCTCTTTAGTTCCGGAATC pLX_317 24.9% 81.2% 73.5% V5 (many diffs) n/a
19 ccsbBroadEn_10873 pDONR223 100% 81% 71.8% None (many diffs) n/a
20 ccsbBroad304_10873 pLX_304 0% 81% 71.8% V5 (many diffs) n/a
21 TRCN0000467519 TAGATAGCAAGTTGAAAACATAGT pLX_317 37.4% 81% 71.8% V5 (many diffs) n/a
22 ccsbBroadEn_06376 pDONR223 100% 80.8% 70.9% None (many diffs) n/a
23 ccsbBroad304_06376 pLX_304 0% 80.8% 70.9% V5 (many diffs) n/a
24 TRCN0000467116 AGGAAAGTCCTCACAACCTTAAGA pLX_317 32.9% 80.8% 70.9% V5 (many diffs) n/a
25 ccsbBroadEn_15444 pDONR223 0% 80.1% 72.5% None (many diffs) n/a
26 ccsbBroad304_15444 pLX_304 0% 80.1% 72.5% V5 (many diffs) n/a
27 TRCN0000466157 AACATCTTCCGGACGCACAACCGT pLX_317 33.7% 80.1% 72.5% V5 (many diffs) n/a
28 ccsbBroadEn_10875 pDONR223 100% 79.8% 73.2% None (many diffs) n/a
29 ccsbBroad304_10875 pLX_304 0% 79.8% 73.2% V5 (many diffs) n/a
30 TRCN0000469854 ACACCGAACACAATGTCGCAAGTA pLX_317 39.8% 79.8% 73.2% V5 (many diffs) n/a
31 ccsbBroadEn_06377 pDONR223 100% 64.9% 59.1% None (many diffs) n/a
32 ccsbBroad304_06377 pLX_304 0% 64.9% 59.1% V5 (many diffs) n/a
33 TRCN0000468057 TTATGCCGCCCGGCTCAGACGATT pLX_317 25.1% 64.9% 59.1% V5 (many diffs) n/a
34 ccsbBroadEn_10885 pDONR223 100% 30.4% 24.4% None (many diffs) n/a
35 ccsbBroad304_10885 pLX_304 0% 30.4% 24.4% V5 (many diffs) n/a
36 TRCN0000480644 ACTGTGAATCATTCCCGCTCGGTA pLX_317 62.4% 30.3% 24.1% V5 (many diffs) n/a
37 ccsbBroadEn_13715 pDONR223 100% 26.5% 21.8% None (many diffs) n/a
38 ccsbBroad304_13715 pLX_304 0% 26.5% 21.8% V5 (many diffs) n/a
39 TRCN0000473122 GGGTCAGTAGTGGATGTACCAGTA pLX_317 100% 26.5% 21.8% V5 (many diffs) n/a
40 ccsbBroadEn_13714 pDONR223 100% 25.1% 19.8% None (many diffs) n/a
41 ccsbBroad304_13714 pLX_304 0% 25.1% 19.8% V5 (many diffs) n/a
42 TRCN0000468125 TCGTCTTGCTGTGCCGCTCTGCCA pLX_317 71.7% 25.1% 19.8% V5 (many diffs) n/a
Download CSV