Transcript: Human NR_001434.4

Homo sapiens major histocompatibility complex, class I, H (pseudogene) (HLA-H), non-coding RNA.

Source:
NCBI, updated 2019-02-03
Taxon:
Homo sapiens (human)
Gene:
HLA-H (3136)
Length:
1705
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_001434.4
NBCI Gene record:
HLA-H (3136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_001434.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057341 CCACTCCATGAGGTATTTCTA pLKO.1 263 3UTR 100% 5.625 2.813 Y HLA-B n/a
2 TRCN0000057317 CAAGGATTACATCGCCCTGAA pLKO.1 617 3UTR 100% 4.050 2.025 Y HLA-C n/a
3 TRCN0000057241 CCACTCCATGAGGTATTTCTT pLKO.1 263 3UTR 100% 5.625 2.813 Y HLA-A n/a
4 TRCN0000299015 CCACTCCATGAGGTATTTCTT pLKO_005 263 3UTR 100% 5.625 2.813 Y HLA-A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_001434.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10873 pDONR223 100% 59.6% None (many diffs) n/a
2 ccsbBroad304_10873 pLX_304 0% 59.6% V5 (many diffs) n/a
3 TRCN0000467519 TAGATAGCAAGTTGAAAACATAGT pLX_317 37.4% 59.6% V5 (many diffs) n/a
4 ccsbBroad304_13869 pLX_304 38.8% 59.3% V5 (many diffs) n/a
5 TRCN0000478257 GCGAGGCAGAGTCGTTTTGCCCGA pLX_317 25.5% 59.3% V5 (many diffs) n/a
6 ccsbBroadEn_13869 pDONR223 100% 59.1% None (many diffs) n/a
7 ccsbBroadEn_15443 pDONR223 0% 58.5% None (many diffs) n/a
8 ccsbBroad304_15443 pLX_304 0% 58.5% V5 (many diffs) n/a
9 TRCN0000474782 GACCCAGCCTCAGCGGGTCATATA pLX_317 48.2% 58.5% V5 (many diffs) n/a
10 ccsbBroadEn_10874 pDONR223 100% 58.2% None (many diffs) n/a
11 ccsbBroad304_10874 pLX_304 0% 58.2% V5 (many diffs) n/a
12 TRCN0000466537 CCTTGTCTCTTTAGTTCCGGAATC pLX_317 24.9% 58.2% V5 (many diffs) n/a
13 ccsbBroadEn_10876 pDONR223 100% 57.7% None (many diffs) n/a
14 ccsbBroad304_10876 pLX_304 0% 57.7% V5 (many diffs) n/a
15 TRCN0000480126 GGTTTAAAAAATATATTGATCTAG pLX_317 37.2% 57.7% V5 (many diffs) n/a
16 ccsbBroadEn_15444 pDONR223 0% 57.2% None (many diffs) n/a
17 ccsbBroad304_15444 pLX_304 0% 57.2% V5 (many diffs) n/a
18 TRCN0000466157 AACATCTTCCGGACGCACAACCGT pLX_317 33.7% 57.2% V5 (many diffs) n/a
19 ccsbBroadEn_10875 pDONR223 100% 57% None (many diffs) n/a
20 ccsbBroad304_10875 pLX_304 0% 57% V5 (many diffs) n/a
21 TRCN0000469854 ACACCGAACACAATGTCGCAAGTA pLX_317 39.8% 57% V5 (many diffs) n/a
22 ccsbBroadEn_06376 pDONR223 100% 54.5% None (many diffs) n/a
23 ccsbBroad304_06376 pLX_304 0% 54.5% V5 (many diffs) n/a
24 TRCN0000467116 AGGAAAGTCCTCACAACCTTAAGA pLX_317 32.9% 54.5% V5 (many diffs) n/a
25 ccsbBroadEn_06378 pDONR223 100% 53.1% None (many diffs) n/a
26 ccsbBroad304_06378 pLX_304 0% 53.1% V5 (many diffs) n/a
27 TRCN0000469084 CCGCATGATACGGACCGACTTCAA pLX_317 36.9% 53.1% V5 (many diffs) n/a
28 ccsbBroadEn_06379 pDONR223 100% 52.8% None (many diffs) n/a
29 ccsbBroad304_06379 pLX_304 0% 52.8% V5 (many diffs) n/a
30 TRCN0000465566 TATGGTTATTATAGCAGACTCGAC pLX_317 34% 52.8% V5 (many diffs) n/a
31 ccsbBroadEn_13714 pDONR223 100% 25.4% None (many diffs) n/a
32 ccsbBroad304_13714 pLX_304 0% 25.4% V5 (many diffs) n/a
33 TRCN0000468125 TCGTCTTGCTGTGCCGCTCTGCCA pLX_317 71.7% 25.4% V5 (many diffs) n/a
Download CSV