Transcript: Human NM_001178014.1

Homo sapiens propionyl-CoA carboxylase subunit beta (PCCB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PCCB (5096)
Length:
1885
CDS:
52..1731

Additional Resources:

NCBI RefSeq record:
NM_001178014.1
NBCI Gene record:
PCCB (5096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078428 GCAGAGTACATCGAGAAGTTT pLKO.1 1561 CDS 100% 5.625 4.500 N PCCB n/a
2 TRCN0000333347 GCAGAGTACATCGAGAAGTTT pLKO_005 1561 CDS 100% 5.625 4.500 N PCCB n/a
3 TRCN0000078429 GCCCAATTATGCCAAGAACAT pLKO.1 1110 CDS 100% 4.950 3.960 N PCCB n/a
4 TRCN0000344762 CCTCAGGATGCTTGGATATTA pLKO_005 1196 CDS 100% 15.000 10.500 N PCCB n/a
5 TRCN0000112471 GCTGCTGATAAGAATAAGTTT pLKO.1 337 CDS 100% 5.625 3.938 N Pccb n/a
6 TRCN0000078432 GCAGACATCTTTCTGAGGAAT pLKO.1 640 CDS 100% 4.950 3.465 N PCCB n/a
7 TRCN0000333416 GCAGACATCTTTCTGAGGAAT pLKO_005 640 CDS 100% 4.950 3.465 N PCCB n/a
8 TRCN0000078431 GTGGACATCATACACTCTGTT pLKO.1 1060 CDS 100% 4.950 3.465 N PCCB n/a
9 TRCN0000078430 CCTTGTGTAATCTCCGGGATT pLKO.1 911 CDS 100% 4.050 2.835 N PCCB n/a
10 TRCN0000333417 CCTTGTGTAATCTCCGGGATT pLKO_005 911 CDS 100% 4.050 2.835 N PCCB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01150 pDONR223 100% 96.4% 96.4% None 371_430del n/a
2 ccsbBroad304_01150 pLX_304 0% 96.4% 96.4% V5 371_430del n/a
3 TRCN0000466268 GGCCCTATAACGGGCCCAATGTCC pLX_317 13.2% 96.4% 96.4% V5 371_430del n/a
Download CSV