Construct: ORF TRCN0000466562
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000996.1_s317c1
- Derived from:
- ccsbBroadEn_03954
- DNA Barcode:
- CGTCACCCAGTGACCATTACTCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPEB1 (64506)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466562
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_030594.5 | 100% | 100% | |
2 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365243.1 | 99.1% | 99.1% | 1060_1074del |
3 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365240.1 | 95.1% | 94.8% | (many diffs) |
4 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365241.1 | 95.1% | 94.8% | (many diffs) |
5 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365242.1 | 95.1% | 94.8% | (many diffs) |
6 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001079534.2 | 86.6% | 86.6% | 0_1ins225 |
7 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001079535.2 | 86.6% | 86.6% | 0_1ins225 |
8 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001288819.1 | 86.6% | 86.6% | 0_1ins225 |
9 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365244.1 | 86.6% | 86.6% | 0_1ins225 |
10 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365245.1 | 86.6% | 86.6% | 0_1ins225 |
11 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365246.1 | 86.6% | 86.6% | 0_1ins225 |
12 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365247.1 | 86.6% | 86.6% | 0_1ins225 |
13 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365248.1 | 86.6% | 86.6% | 0_1ins225 |
14 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365249.1 | 86.6% | 86.6% | 0_1ins225 |
15 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001079533.2 | 85.8% | 85.8% | 0_1ins225;835_849del |
16 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001365250.1 | 85.8% | 85.8% | 0_1ins225;835_849del |
17 | human | 64506 | CPEB1 | cytoplasmic polyadenylation... | NM_001288820.2 | 59.7% | 59.7% | 0_1ins678 |
18 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | NM_001252526.1 | 91.2% | 95.1% | (many diffs) |
19 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | NM_007755.5 | 90.4% | 94.3% | (many diffs) |
20 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | NM_001252525.1 | 90.2% | 94.1% | (many diffs) |
21 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250787.2 | 85.3% | 88.6% | (many diffs) |
22 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250786.2 | 85.1% | 88.5% | (many diffs) |
23 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250785.2 | 84.6% | 87.9% | (many diffs) |
24 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250784.2 | 84.4% | 87.7% | (many diffs) |
25 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250788.2 | 83.2% | 86.5% | (many diffs) |
26 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250790.2 | 78.5% | 82.1% | (many diffs) |
27 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_017321964.1 | 78.5% | 82.1% | (many diffs) |
28 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_017321965.1 | 75.6% | 77.3% | (many diffs) |
29 | mouse | 12877 | Cpeb1 | cytoplasmic polyadenylation... | XM_011250792.1 | 69.4% | 73.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1749
- ORF length:
- 1683
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gttcccgctg gaagaagaag caggaaggat aaaagattgc tgggacaacc 121 aggaagcacc tgctctctcc acgtgtagta atgccaatat ctttcgaagg ataaatgcca 181 tattggataa ttctctggat ttcagtagag tctgcactac acctataaac cgaggaattc 241 atgatcattt gccagacttc caggactctg aagaaacagt tacaagcagg atgcttttcc 301 caacctctgc gcaagaatct tcccgtggcc tcccagatgc aaatgacttg tgccttggcc 361 tgcagtccct cagtctgaca ggctgggacc gaccctggag cacccaggac tcagattcct 421 cagcccagag cagcacacac tcggtactga gcatgctcca taacccactg ggaaatgtcc 481 taggaaaacc ccccttgagc ttcctgcctc tggatcccct tgggtctgac ttggtggaca 541 agtttccagc accctcagtt agaggatcac gcctggacac ccggcccatc ctggactctc 601 gatctagcag cccctctgac tcagacacca gtggcttcag ctctggatca gatcatctct 661 cagatttgat ttcaagcctt cgcatttctc cacctctgcc cttcctgtct ctgtcagggg 721 gtggtcccag agacccttta aagatggggg tagggtctcg gatggaccaa gagcaagctg 781 ctcttgctgc agtcactccc tccccaacca gtgcttcaaa gagatggcca ggagcttctg 841 tgtggccatc ctgggacctc ctcgaagctc ccaaagaccc cttcagcata gagagagagg 901 ccaggctgca ccgacaagct gcagctgtga atgaagccac ctgtacctgg agtggccagc 961 ttcctccccg gaactataag aaccccatct actcttgcaa ggtgtttcta ggaggtgttc 1021 cttgggatat tacagaagct ggattagtta acaccttccg tgtttttggc tctttgagtg 1081 tggagtggcc tggtaaggat ggcaagcatc cccggtgtcc tcccaaaggg tatgtgtatc 1141 tggtcttcga actagagaag tctgtccgat ccttgcttca ggcttgctct catgacccgc 1201 tgagcccaga tggcctgagt gaatattatt tcaagatgtc cagccgaagg atgcgctgca 1261 aggaggtgca ggtgatcccc tgggtattag ccgacagtaa ctttgtccgg agcccatctc 1321 agaggcttga ccccagcagg acggtgtttG TCGGTGCTCT GCATGGAATG CTAAATGCTG 1381 AGGCCCTGGC AGCCATCTTG AACGACCTAT TTGGTGGAGT GGTGTATGCC GGGATTGACA 1441 CAGATAAGCA CAAGTATCCC ATTGGTTCTG GTCGTGTGAC TTTCAATAAC CAACGGAGTT 1501 ACCTGAAAGC AGTCAGCGCT GCTTTTGTGG AGATCAAAAC CACCAAGTTC ACAAAGAAGG 1561 TTCAGATTGA CCCCTACCTA GAAGATTCTC TGTGTCATAT CTGCAGTTCT CAGCCTGGTC 1621 CTTTCTTCTG TCGAGATCAG GTCTGCTTCA AATACTTCTG CCGGAGCTGC TGGCACTGGC 1681 GGCACAGCAT GGAGGGCCTG CGCCACCACA GCCCCCTGAT GCGGAACCAG AAGAACCGAG 1741 ATTCCAGCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1801 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1861 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACGTCAC CCAGTGACCA TTACTCCAAC 1921 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt