Transcript: Human NM_001365240.1

Homo sapiens cytoplasmic polyadenylation element binding protein 1 (CPEB1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CPEB1 (64506)
Length:
3612
CDS:
455..2221

Additional Resources:

NCBI RefSeq record:
NM_001365240.1
NBCI Gene record:
CPEB1 (64506)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422593 AGTCTGCACTACACCTATAAA pLKO_005 679 CDS 100% 15.000 12.000 N CPEB1 n/a
2 TRCN0000183837 CGTGTGACTTTCAATAACCAA pLKO.1 1943 CDS 100% 3.000 2.400 N CPEB1 n/a
3 TRCN0000426468 GATGCCTACACCTAGGTTTAT pLKO_005 2575 3UTR 100% 13.200 9.240 N CPEB1 n/a
4 TRCN0000240543 GTCTTTGTTTCTGCACTAATT pLKO_005 2366 3UTR 100% 13.200 9.240 N Cpeb1 n/a
5 TRCN0000240545 TGATTTCAAGCCTTCGCATTT pLKO_005 1137 CDS 100% 10.800 7.560 N Cpeb1 n/a
6 TRCN0000180018 CGCAGGTCTCATTGGTTTCAT pLKO.1 2645 3UTR 100% 5.625 3.938 N CPEB1 n/a
7 TRCN0000149456 GCAGGTCTCATTGGTTTCATT pLKO.1 2646 3UTR 100% 5.625 3.938 N CPEB1 n/a
8 TRCN0000149470 GCACTTGCTGAATCTGTCTTT pLKO.1 2351 3UTR 100% 4.950 3.465 N CPEB1 n/a
9 TRCN0000183444 GCCAATATCTTTCGAAGGATA pLKO.1 623 CDS 100% 4.950 3.465 N CPEB1 n/a
10 TRCN0000202301 GCCATACAGTGCCTTTCCATT pLKO.1 2676 3UTR 100% 4.950 3.465 N Cpeb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03954 pDONR223 100% 95.1% 94.8% None (many diffs) n/a
2 ccsbBroad304_03954 pLX_304 0% 95.1% 94.8% V5 (many diffs) n/a
3 TRCN0000466562 CGTCACCCAGTGACCATTACTCCA pLX_317 24% 95.1% 94.8% V5 (many diffs) n/a
4 ccsbBroadEn_08857 pDONR223 100% 82.5% 82.6% None 1_306del;1596A>G n/a
5 ccsbBroad304_08857 pLX_304 0% 82.5% 82.6% V5 1_306del;1596A>G n/a
6 TRCN0000492111 AACCCGCAACATGCCCGGTGGTCA pLX_317 23.2% 82.5% 82.6% V5 1_306del;1596A>G n/a
Download CSV